ID: 923558951

View in Genome Browser
Species Human (GRCh38)
Location 1:235023768-235023790
Sequence CCTTCGGGGGAGGGGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923558937_923558951 24 Left 923558937 1:235023721-235023743 CCTACATGAAACTTTCACGGTGG No data
Right 923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923558951 Original CRISPR CCTTCGGGGGAGGGGTGGGA GGG Intergenic
No off target data available for this crispr