ID: 923559600

View in Genome Browser
Species Human (GRCh38)
Location 1:235028488-235028510
Sequence AACCAGGCTCAGAGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923559592_923559600 26 Left 923559592 1:235028439-235028461 CCAAAGCTACAGGAGCTGAGGAT No data
Right 923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG No data
923559595_923559600 -5 Left 923559595 1:235028470-235028492 CCATTTGCAGGTGAGGAAAACCA No data
Right 923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923559600 Original CRISPR AACCAGGCTCAGAGAGGGGA AGG Intergenic
No off target data available for this crispr