ID: 923560455

View in Genome Browser
Species Human (GRCh38)
Location 1:235036315-235036337
Sequence AAATGTACACTGCAAATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923560455_923560457 24 Left 923560455 1:235036315-235036337 CCTAGAATTTGCAGTGTACATTT No data
Right 923560457 1:235036362-235036384 AATAACACCATGCCACTTCATGG No data
923560455_923560458 25 Left 923560455 1:235036315-235036337 CCTAGAATTTGCAGTGTACATTT No data
Right 923560458 1:235036363-235036385 ATAACACCATGCCACTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923560455 Original CRISPR AAATGTACACTGCAAATTCT AGG (reversed) Intergenic
No off target data available for this crispr