ID: 923561986

View in Genome Browser
Species Human (GRCh38)
Location 1:235048506-235048528
Sequence CATTAAAACCAAGGGCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923561975_923561986 29 Left 923561975 1:235048454-235048476 CCCCTGTGATCACCGGGGCCAGG No data
Right 923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG No data
923561978_923561986 27 Left 923561978 1:235048456-235048478 CCTGTGATCACCGGGGCCAGGAA No data
Right 923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG No data
923561977_923561986 28 Left 923561977 1:235048455-235048477 CCCTGTGATCACCGGGGCCAGGA No data
Right 923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG No data
923561980_923561986 11 Left 923561980 1:235048472-235048494 CCAGGAATACTGAGCAAAAAGCA No data
Right 923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG No data
923561979_923561986 17 Left 923561979 1:235048466-235048488 CCGGGGCCAGGAATACTGAGCAA No data
Right 923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923561986 Original CRISPR CATTAAAACCAAGGGCAGCC GGG Intergenic
No off target data available for this crispr