ID: 923567037

View in Genome Browser
Species Human (GRCh38)
Location 1:235083996-235084018
Sequence GACTGGCCCTTGCCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567037_923567040 -2 Left 923567037 1:235083996-235084018 CCTGCCTGTGGCAAGGGCCAGTC No data
Right 923567040 1:235084017-235084039 TCTTCAGCCTCCCAGACAGATGG No data
923567037_923567046 30 Left 923567037 1:235083996-235084018 CCTGCCTGTGGCAAGGGCCAGTC No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567037 Original CRISPR GACTGGCCCTTGCCACAGGC AGG (reversed) Intergenic