ID: 923567038

View in Genome Browser
Species Human (GRCh38)
Location 1:235084000-235084022
Sequence TGAAGACTGGCCCTTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567038_923567048 29 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567038_923567040 -6 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567040 1:235084017-235084039 TCTTCAGCCTCCCAGACAGATGG No data
923567038_923567046 26 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567038 Original CRISPR TGAAGACTGGCCCTTGCCAC AGG (reversed) Intergenic