ID: 923567039

View in Genome Browser
Species Human (GRCh38)
Location 1:235084013-235084035
Sequence CTGTCTGGGAGGCTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567039_923567051 20 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567051 1:235084056-235084078 AGAACGATCTGCAAGGAGGTGGG No data
923567039_923567046 13 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567039_923567048 16 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567039_923567050 19 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567039_923567052 25 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567039 Original CRISPR CTGTCTGGGAGGCTGAAGAC TGG (reversed) Intergenic