ID: 923567040

View in Genome Browser
Species Human (GRCh38)
Location 1:235084017-235084039
Sequence TCTTCAGCCTCCCAGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567037_923567040 -2 Left 923567037 1:235083996-235084018 CCTGCCTGTGGCAAGGGCCAGTC No data
Right 923567040 1:235084017-235084039 TCTTCAGCCTCCCAGACAGATGG No data
923567036_923567040 -1 Left 923567036 1:235083995-235084017 CCCTGCCTGTGGCAAGGGCCAGT No data
Right 923567040 1:235084017-235084039 TCTTCAGCCTCCCAGACAGATGG No data
923567038_923567040 -6 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567040 1:235084017-235084039 TCTTCAGCCTCCCAGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567040 Original CRISPR TCTTCAGCCTCCCAGACAGA TGG Intergenic