ID: 923567041

View in Genome Browser
Species Human (GRCh38)
Location 1:235084024-235084046
Sequence TGTTTGGCCATCTGTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567041_923567051 9 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567051 1:235084056-235084078 AGAACGATCTGCAAGGAGGTGGG No data
923567041_923567052 14 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567041_923567046 2 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567041_923567050 8 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567041_923567048 5 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567041 Original CRISPR TGTTTGGCCATCTGTCTGGG AGG (reversed) Intergenic