ID: 923567042

View in Genome Browser
Species Human (GRCh38)
Location 1:235084027-235084049
Sequence AGGTGTTTGGCCATCTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567042_923567051 6 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567051 1:235084056-235084078 AGAACGATCTGCAAGGAGGTGGG No data
923567042_923567050 5 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567042_923567052 11 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567042_923567048 2 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567042_923567053 29 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567042_923567046 -1 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567042 Original CRISPR AGGTGTTTGGCCATCTGTCT GGG (reversed) Intergenic
No off target data available for this crispr