ID: 923567044

View in Genome Browser
Species Human (GRCh38)
Location 1:235084040-235084062
Sequence TCGTTCTAGGGAAAGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567044_923567053 16 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567044_923567050 -8 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567044_923567052 -2 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567044_923567051 -7 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567051 1:235084056-235084078 AGAACGATCTGCAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567044 Original CRISPR TCGTTCTAGGGAAAGGTGTT TGG (reversed) Intergenic