ID: 923567045

View in Genome Browser
Species Human (GRCh38)
Location 1:235084047-235084069
Sequence TTGCAGATCGTTCTAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567045_923567053 9 Left 923567045 1:235084047-235084069 CCTTTCCCTAGAACGATCTGCAA No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567045_923567052 -9 Left 923567045 1:235084047-235084069 CCTTTCCCTAGAACGATCTGCAA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567045 Original CRISPR TTGCAGATCGTTCTAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr