ID: 923567046

View in Genome Browser
Species Human (GRCh38)
Location 1:235084049-235084071
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567041_923567046 2 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567037_923567046 30 Left 923567037 1:235083996-235084018 CCTGCCTGTGGCAAGGGCCAGTC No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567039_923567046 13 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567043_923567046 -2 Left 923567043 1:235084028-235084050 CCAGACAGATGGCCAAACACCTT No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567038_923567046 26 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data
923567042_923567046 -1 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567046 1:235084049-235084071 TTTCCCTAGAACGATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr