ID: 923567048

View in Genome Browser
Species Human (GRCh38)
Location 1:235084052-235084074
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567042_923567048 2 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567038_923567048 29 Left 923567038 1:235084000-235084022 CCTGTGGCAAGGGCCAGTCTTCA No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567039_923567048 16 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567043_923567048 1 Left 923567043 1:235084028-235084050 CCAGACAGATGGCCAAACACCTT No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
923567041_923567048 5 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567048 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr