ID: 923567049

View in Genome Browser
Species Human (GRCh38)
Location 1:235084053-235084075
Sequence ACCTCCTTGCAGATCGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567049_923567057 27 Left 923567049 1:235084053-235084075 CCTAGAACGATCTGCAAGGAGGT No data
Right 923567057 1:235084103-235084125 ATAATGCACAAGCACCTTGATGG No data
923567049_923567053 3 Left 923567049 1:235084053-235084075 CCTAGAACGATCTGCAAGGAGGT No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923567049 Original CRISPR ACCTCCTTGCAGATCGTTCT AGG (reversed) Intergenic