ID: 923567050

View in Genome Browser
Species Human (GRCh38)
Location 1:235084055-235084077
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567043_923567050 4 Left 923567043 1:235084028-235084050 CCAGACAGATGGCCAAACACCTT No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567039_923567050 19 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567044_923567050 -8 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567041_923567050 8 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data
923567042_923567050 5 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567050 1:235084055-235084077 TAGAACGATCTGCAAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type