ID: 923567052

View in Genome Browser
Species Human (GRCh38)
Location 1:235084061-235084083
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567045_923567052 -9 Left 923567045 1:235084047-235084069 CCTTTCCCTAGAACGATCTGCAA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567039_923567052 25 Left 923567039 1:235084013-235084035 CCAGTCTTCAGCCTCCCAGACAG No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567041_923567052 14 Left 923567041 1:235084024-235084046 CCTCCCAGACAGATGGCCAAACA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567042_923567052 11 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567044_923567052 -2 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data
923567043_923567052 10 Left 923567043 1:235084028-235084050 CCAGACAGATGGCCAAACACCTT No data
Right 923567052 1:235084061-235084083 GATCTGCAAGGAGGTGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type