ID: 923567053

View in Genome Browser
Species Human (GRCh38)
Location 1:235084079-235084101
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923567045_923567053 9 Left 923567045 1:235084047-235084069 CCTTTCCCTAGAACGATCTGCAA No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567043_923567053 28 Left 923567043 1:235084028-235084050 CCAGACAGATGGCCAAACACCTT No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567047_923567053 4 Left 923567047 1:235084052-235084074 CCCTAGAACGATCTGCAAGGAGG No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567049_923567053 3 Left 923567049 1:235084053-235084075 CCTAGAACGATCTGCAAGGAGGT No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567044_923567053 16 Left 923567044 1:235084040-235084062 CCAAACACCTTTCCCTAGAACGA No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data
923567042_923567053 29 Left 923567042 1:235084027-235084049 CCCAGACAGATGGCCAAACACCT No data
Right 923567053 1:235084079-235084101 TAAGGTATCTCCCCAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type