ID: 923573518

View in Genome Browser
Species Human (GRCh38)
Location 1:235137800-235137822
Sequence CCTTCCAGGCTTTTCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923573518 Original CRISPR CCTTCCAGGCTTTTCCTGGA AGG (reversed) Intronic
900906779 1:5564809-5564831 TCTTCCATGCTTTGCCTGCAAGG - Intergenic
900940152 1:5793366-5793388 CCTTCCATGCGCTACCTGGAGGG - Intergenic
900959750 1:5911273-5911295 TCTTTCAGGCTTTTTCTGGGAGG - Intronic
901951955 1:12756441-12756463 CTTTCCCTGCTGTTCCTGGAAGG - Intronic
902376235 1:16031274-16031296 CCTTCCAAGTTTTTCCTTGGGGG + Intronic
902503686 1:16926237-16926259 CCTCAAAGGCCTTTCCTGGAGGG + Intronic
902798415 1:18814621-18814643 CCTTCTCTGCTTTTCCTGCAGGG - Intergenic
904331161 1:29758506-29758528 ACCACCAGGCTTTACCTGGAGGG + Intergenic
904903074 1:33872912-33872934 ACTTGCAGTCTTTTCCTGGCTGG + Intronic
904910226 1:33929109-33929131 ACTCCTAGGCTTTTCCTGGAGGG - Intronic
907861217 1:58355599-58355621 CCTTCCACTCCTTTCCTGGTAGG + Intronic
909896416 1:81076128-81076150 TTTTCAAGGCTTTTCTTGGAAGG - Intergenic
912595461 1:110871433-110871455 CCAGTCAGGCCTTTCCTGGATGG + Intergenic
913067131 1:115266518-115266540 CCTTTGAGGCTTTTCTTGAATGG - Intergenic
913231105 1:116741401-116741423 CCTTCCAGGAGTTTTCTGTAAGG + Intergenic
914212791 1:145596223-145596245 CTTTCCTGGGTTTTACTGGAGGG + Intergenic
915290840 1:154882152-154882174 GCTTCCAGGCTGTTCTTGGCTGG + Intergenic
915626882 1:157119293-157119315 CCTCCACGGCCTTTCCTGGAAGG - Intergenic
917670888 1:177272369-177272391 CATTCCAGGCTTTTCAGGGTAGG - Intronic
920177948 1:204114793-204114815 CCTACCAGGCCTCTCCTGCATGG - Intronic
922168560 1:223136016-223136038 ACTTGCAGGCTATTCCTGGTAGG - Intronic
922756854 1:228101776-228101798 CCTCCAGGGCTTCTCCTGGATGG - Intronic
923224015 1:231922678-231922700 CCCTCCAGGGTTATCCTGGCTGG - Intronic
923573518 1:235137800-235137822 CCTTCCAGGCTTTTCCTGGAAGG - Intronic
1063088760 10:2842782-2842804 CCTTCCAGGCTTTTCATCTTAGG + Intergenic
1069908803 10:71747647-71747669 CCTCCCAGGATTTTCAGGGAAGG + Exonic
1070810281 10:79294093-79294115 CCTTCCAGTCACTTCCCGGACGG - Intronic
1074051665 10:109886327-109886349 TCTTGCAGGCATCTCCTGGAAGG - Exonic
1074431528 10:113398931-113398953 CTTTCCAGCTTTTTCCTGGGTGG + Intergenic
1074611797 10:115028834-115028856 GCTTAAAGGCTTTTCTTGGATGG - Intergenic
1075512059 10:123080611-123080633 CATTCCATACTCTTCCTGGATGG - Intergenic
1075745444 10:124724309-124724331 CCTTCCCAGCTTTTGGTGGAAGG + Intronic
1076290687 10:129343349-129343371 ACTTCCTGGCCTCTCCTGGATGG + Intergenic
1076928387 10:133507778-133507800 CCTTCCAGTTTCTCCCTGGAAGG + Intergenic
1077659993 11:4059229-4059251 CCTTCCTGGCTTTACTGGGAGGG + Intronic
1078327823 11:10394907-10394929 CAAGCCAGGCTATTCCTGGAAGG + Intronic
1078936220 11:15952652-15952674 CCTTCCAGTCTCTGCCTGGTAGG - Intergenic
1080179891 11:29412824-29412846 CCTTCATGTCTTTTCATGGATGG + Intergenic
1082786042 11:57317375-57317397 CCTCCCATGCTTTCCCTGGCTGG - Intronic
1082892713 11:58157289-58157311 CCTCCCAGGCCTTCCCTGAAGGG + Intronic
1083805022 11:65068247-65068269 CCTACCAGGCTTTCCCTACAGGG - Intronic
1084870174 11:72093390-72093412 CCATCCAGGCTGTAGCTGGAGGG - Intronic
1087181195 11:95144146-95144168 CCTTCCATGATTTTCCAGGTTGG + Intergenic
1087873770 11:103331286-103331308 CCTTACAGGCTTTTTCTCCATGG + Intronic
1089012277 11:115141094-115141116 ACTGCCAGGCTTTTCATGCATGG + Intergenic
1090154509 11:124423644-124423666 CCTTCCATTCTTTTCTTGGTAGG - Intergenic
1091666575 12:2423020-2423042 CCTTCCAAGCTAATCCTCGATGG - Intronic
1092163028 12:6326527-6326549 CCCTCCACGCCTTCCCTGGAGGG + Exonic
1092169413 12:6363809-6363831 CCGCCCAGGCTTCTCCGGGATGG - Intronic
1094074553 12:26458446-26458468 CCTTTCTGGCTTCCCCTGGAAGG - Intronic
1094115670 12:26909717-26909739 CCTTTCAGGCATTTGCTAGAGGG - Intronic
1095563311 12:43590914-43590936 CCTTCCAAGCCTTTCCTCCATGG + Intergenic
1100593493 12:96051771-96051793 CCTTCCTCTCTTTTCCTGAAGGG - Intergenic
1100667151 12:96767582-96767604 CCTTCCAGTCCTTTCCTGGCAGG + Intronic
1101529278 12:105559547-105559569 CCTTCCTTGCCTTTCCCGGAAGG - Intergenic
1101745529 12:107538643-107538665 CCCTCCAGGCTCTTCCTGCTTGG + Intronic
1103840176 12:123857240-123857262 TTTTCCTGGCTTTACCTGGATGG - Exonic
1104501471 12:129290215-129290237 GCTTCCAGGATTAACCTGGAAGG - Intronic
1107575797 13:41720726-41720748 CTTTCTAGGGTTTTCTTGGAGGG + Intronic
1107606271 13:42060419-42060441 CCTACCAGACATTTCCTGTAGGG + Intronic
1108455592 13:50610580-50610602 CCCTCCTGGACTTTCCTGGAGGG - Intronic
1108571910 13:51760227-51760249 CCTTCTCTGCCTTTCCTGGAGGG + Exonic
1109219877 13:59630310-59630332 GCTTCCAGTCCTTCCCTGGATGG - Intergenic
1110007122 13:70287027-70287049 TCTTCCAGGCTTTACCTCTATGG - Intergenic
1114043246 14:18699527-18699549 CCAGCCAGTGTTTTCCTGGATGG - Intergenic
1114047537 14:18889973-18889995 CCAGCCAGTGTTTTCCTGGATGG - Intergenic
1114114986 14:19511672-19511694 CCAGCCAGTGTTTTCCTGGATGG + Intergenic
1114116677 14:19629435-19629457 CCAGCCAGTGTTTTCCTGGATGG + Intergenic
1115367731 14:32577446-32577468 TTTTCAAAGCTTTTCCTGGAAGG + Intronic
1118600638 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG + Intronic
1120183601 14:81369758-81369780 CTTTCCAGGCCTTTCCAGGGAGG - Intronic
1122364792 14:101188249-101188271 CCTCCCTGGCTCCTCCTGGAGGG - Intergenic
1122576556 14:102746695-102746717 CCTGCCCGGCTCTTCCTGCAGGG - Intergenic
1123791729 15:23727957-23727979 CCTGCCAGGCAGTTCCTTGATGG - Intergenic
1125583929 15:40807199-40807221 GCTCCCAGACATTTCCTGGACGG - Exonic
1128061633 15:64739153-64739175 CCTTTCAGACTCTTACTGGAGGG - Intergenic
1128213477 15:65917988-65918010 CCTGCCAGTGCTTTCCTGGATGG - Exonic
1129365138 15:75049450-75049472 CCTCCCCACCTTTTCCTGGATGG + Exonic
1129446786 15:75624718-75624740 CCTTCAAGGCTGTTCTTGGCGGG + Exonic
1129515531 15:76154858-76154880 TCCTTCAGGCTTTCCCTGGATGG + Intronic
1130662268 15:85840161-85840183 CCTTCCAGCTTCTTCGTGGAGGG - Intergenic
1132701881 16:1225480-1225502 CCTTCCCCGCTTTCCCTTGACGG - Intergenic
1136553892 16:30996875-30996897 CCTTCCAGGCATTTCCTCTCTGG - Intronic
1136866388 16:33759864-33759886 CCTTCCTGGCTCTTACTGGAAGG + Intergenic
1137265901 16:46868681-46868703 CCTTCCAGGCCTGTGATGGAAGG + Intergenic
1138115376 16:54356752-54356774 CCCTCTAGCCTTTTCCTGGTTGG + Intergenic
1139268117 16:65658465-65658487 TCTTCCGGGTTTGTCCTGGACGG - Intergenic
1140966949 16:79976134-79976156 ATTTCCAGGTGTTTCCTGGATGG - Intergenic
1141703062 16:85651242-85651264 CCTGCCGGGCCTTGCCTGGATGG + Intronic
1142069023 16:88079496-88079518 CCTTCCAGCCTTTTTCTGCAGGG - Intronic
1203105771 16_KI270728v1_random:1356336-1356358 CCTTCCTGGCTCTTACTGGAAGG - Intergenic
1203127743 16_KI270728v1_random:1606032-1606054 CCTTCCTGGCTCTTACTGGAAGG + Intergenic
1143371880 17:6445309-6445331 GTTTCCAGGCGTTTCCAGGAGGG - Exonic
1147944363 17:44072107-44072129 CCTTCCACTCTTTTCCACGAGGG + Intronic
1151182904 17:72342704-72342726 ACTTCCAGTCCTTTCCTGGCCGG - Intergenic
1151670969 17:75571560-75571582 CCTTCCAGCCTCTCCCAGGAGGG + Intronic
1152156541 17:78637365-78637387 CTTTCCAGGGTTGTCCGGGAAGG + Intergenic
1152252285 17:79218434-79218456 CCTTCCAGGCTATTTTGGGATGG - Intronic
1152468659 17:80478716-80478738 CCTGCCTGGCTTTTCCTCCAGGG + Intergenic
1152544217 17:80992498-80992520 CCTTCCAGTCCTGGCCTGGATGG - Intronic
1153473622 18:5472993-5473015 GATTCCAGGCCTATCCTGGAGGG + Intronic
1153758020 18:8302806-8302828 CCTTCCAGTATTATCCAGGATGG + Intronic
1153853640 18:9122664-9122686 CCTACCAAGCTTTTTCTGAATGG - Exonic
1154443550 18:14414345-14414367 CATTCCAGGCTTTCTCTGGGAGG + Intergenic
1154937915 18:21079532-21079554 CCCATCAGGCATTTCCTGGAGGG + Intronic
1156223737 18:35081494-35081516 CCTTCTGGGCTTTCTCTGGACGG + Intronic
1156609235 18:38707066-38707088 CCTCCCACTCTTTTCCTGCAAGG + Intergenic
1156929074 18:42618939-42618961 CCTTCTATGCTTTTGCTGAATGG + Intergenic
1159014510 18:63090156-63090178 CCTTTCTGGCTTGTCCAGGAAGG + Intergenic
1164324289 19:24178569-24178591 CCTTCCAGGCCCTTTCTGGCAGG - Intergenic
1164397950 19:27882322-27882344 CCTTAGAGGCTTTTTCTGTATGG - Intergenic
1164837338 19:31365418-31365440 CCTTCCTGGATTGTCCTGGGTGG + Intergenic
1164860547 19:31558988-31559010 CATCCCAGGCTTTTCCATGAAGG + Intergenic
1165362348 19:35344759-35344781 CCTGGCAGCCTTTGCCTGGAAGG - Intronic
1165602864 19:37072566-37072588 CCTTCAAGACTTTTCCTAAAAGG - Intronic
1165739123 19:38195285-38195307 CATTCCTGCTTTTTCCTGGAAGG + Intronic
1165758361 19:38307115-38307137 CCTGCCAGAATTTCCCTGGAAGG - Intronic
1165784918 19:38455720-38455742 CCTCCCATGCTTGTCCAGGAGGG - Exonic
1165904355 19:39184582-39184604 CCCTTCTGGCTTCTCCTGGAAGG - Intergenic
925191141 2:1884779-1884801 CCTTCCTGTCTTGTCCTGGAGGG - Intronic
926887716 2:17613159-17613181 CCTTCCTGGCTATTGGTGGATGG - Intronic
927850092 2:26493457-26493479 CCTGCCATCCCTTTCCTGGAGGG - Intronic
927936591 2:27079738-27079760 CCTGCCCGTCTTCTCCTGGAGGG + Intronic
928922066 2:36536661-36536683 TCTTCCAAGCTTCTCCTTGAAGG - Intronic
929600890 2:43203955-43203977 CCTTGCTGGCTACTCCTGGAGGG - Intergenic
931178981 2:59880990-59881012 CCTTCCAAGCTTTTAATGAATGG - Intergenic
932454941 2:71843559-71843581 GCTTCCAGGCCTGTCCTGGAGGG - Intergenic
934091204 2:88552181-88552203 TCTCCCAGGCTCTTCCTGGGAGG + Intergenic
934635079 2:95978440-95978462 CCTTCCTGGCTCTTACTGGAAGG + Intronic
934798549 2:97126794-97126816 CCTTCCTGGCTCTTACTGGAAGG - Intronic
934834880 2:97576697-97576719 CCTTCCTGGCTCTTACTGGAAGG + Intronic
936036752 2:109119031-109119053 TCCACCAGGCTTTTCTTGGAAGG + Intergenic
937033563 2:118762069-118762091 TCTTCCTGGCTTTCTCTGGAGGG + Intergenic
937524424 2:122749645-122749667 CCTTCCTGCATTTTCATGGAAGG - Intergenic
938113686 2:128589298-128589320 CATTCTTGTCTTTTCCTGGAAGG + Intergenic
938424913 2:131178495-131178517 CCAGCCAGTGTTTTCCTGGATGG - Intronic
939846772 2:147256031-147256053 TCTTGAAGGCTTTTCCTGGCCGG - Intergenic
941268560 2:163395835-163395857 CCTCACTGGCTCTTCCTGGAGGG + Intergenic
942126985 2:172836709-172836731 ATTTCCTGGCTTTACCTGGATGG - Intronic
943369600 2:187001520-187001542 CCCTCCTGGCTTCTCCTGTAGGG - Intergenic
945066218 2:205949747-205949769 CCCTCCTGGCTTCTCCTGTAGGG - Intergenic
946021429 2:216642941-216642963 CCTTGCAGACTTCCCCTGGAGGG - Intronic
946414502 2:219533024-219533046 CCTCCCAATCTCTTCCTGGAGGG + Intronic
947838821 2:233194307-233194329 CCTTCCAGGCTGTCCGGGGAAGG + Intronic
948777844 2:240299137-240299159 CCTTCTGGGCATTTCCTGCAGGG + Intergenic
948899671 2:240949927-240949949 CCTTCCAGCCTCTTCCATGAGGG - Intronic
1168734458 20:118360-118382 CCCTCCAGGCTTTTTCTTCAGGG + Intergenic
1168972454 20:1939961-1939983 TCTTCCAGGCTTTGGCAGGAGGG - Intronic
1168998554 20:2150139-2150161 CCTGCCAGGCTTTTCCGGAGTGG + Intronic
1169544107 20:6633372-6633394 ACTTCCCTGCTTTTCCTGCAGGG + Intergenic
1169812159 20:9619377-9619399 CCTTCCACGCTTCTCTTTGAAGG + Intronic
1171198833 20:23224924-23224946 CCTTCCAGACCTCTCCAGGATGG - Intergenic
1172055597 20:32152300-32152322 CCCTCCAGGATTTCCCTCGATGG + Intronic
1172152585 20:32800904-32800926 CCATACAGGCCTTTCCTGGCTGG - Exonic
1172209599 20:33187412-33187434 CCTTCCCTGCCATTCCTGGAGGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172593644 20:36134655-36134677 GTTTCCAGGCTGTTCCTGCAAGG + Intronic
1173151838 20:40573182-40573204 CCTACCAGACCTTTCCTGGATGG - Intergenic
1173161157 20:40653437-40653459 CCTTCCATTCTTTTCCTTCAGGG + Intergenic
1173291056 20:41715631-41715653 CCTTCCAGGCTTAGCCCAGAGGG - Intergenic
1174090321 20:48041778-48041800 CCCTCCATGCTTACCCTGGAAGG - Intergenic
1174217841 20:48930852-48930874 CCCTCCAGGCCTTTTCTGGCTGG + Intronic
1174619690 20:51864604-51864626 CCACCCAGGCTCTACCTGGAAGG + Intergenic
1176029688 20:63005964-63005986 CCCTCCAGGCCTTTCCTGTCCGG + Exonic
1176084178 20:63288572-63288594 TCTTCCAGGGTGTTCCAGGATGG - Exonic
1176371610 21:6065783-6065805 CTCTCAAGGCTTTTCCTGGGTGG + Intergenic
1177088967 21:16742256-16742278 CCTTCCAGGGAGTTCCTGGCTGG - Intergenic
1179106361 21:38404294-38404316 AGTTCCAGACTTTTCCTGCAGGG + Intronic
1179751909 21:43472756-43472778 CTCTCAAGGCTTTTCCTGGGTGG - Intergenic
1180193873 21:46182278-46182300 TCTTCCAGGCTGGTCCTGGCTGG - Intronic
1180466070 22:15612644-15612666 CCAGCCAGTGTTTTCCTGGATGG - Intergenic
1181044324 22:20207475-20207497 CCTGCCTGGCTCTTCCTGCATGG - Intergenic
1183032563 22:35116799-35116821 ACCTCCAGGCATTTCCTGGGTGG - Intergenic
1183812864 22:40272413-40272435 TCTTCCAGGCCTTTCCTTGAAGG - Intronic
1185235391 22:49709464-49709486 CCTTCCTGGCTTCCCTTGGAAGG - Intergenic
949562260 3:5213823-5213845 CTTTCAAGGCCTTGCCTGGAGGG + Intronic
950701127 3:14748098-14748120 AGTTCCAGGCTTTTCTTGGGGGG + Intronic
954600357 3:51862919-51862941 ACTTCTAGGATCTTCCTGGAAGG - Intronic
955097921 3:55818131-55818153 CCTTCCAGAGCTGTCCTGGAAGG + Intronic
956374219 3:68596906-68596928 CCTTCCAGGTCTTTCCTATAGGG - Intergenic
957137410 3:76307115-76307137 CCTTCCTGGCAGTTCCTGGAAGG + Intronic
957169563 3:76720418-76720440 GCTTCCAGACTTTTTCTGAATGG - Intronic
958883176 3:99696408-99696430 CGGTCCAGGCTTCTCCTGGTAGG - Intronic
959823204 3:110761555-110761577 GGTCCCAGGCTTTTCTTGGAGGG + Intergenic
961109813 3:124274356-124274378 TCTTCCAGTCTTTTCAGGGAAGG + Intronic
962642665 3:137404098-137404120 CCTTCCAGGACTTTTCTGCAGGG - Intergenic
963574395 3:147041640-147041662 CCTTCCAGGCTTTTACAGAACGG - Intergenic
963685175 3:148424178-148424200 CTTTTCAGGTTTTTCATGGATGG - Intergenic
964300440 3:155279857-155279879 CCTTCTCCGCTTTTCTTGGAGGG - Intergenic
964722997 3:159786133-159786155 TCTTCCAGGTATTTCCTGCAGGG - Intronic
966736456 3:183190681-183190703 CCTCACAGGCATTTCCTGGCTGG + Intronic
967375530 3:188796443-188796465 CATTACAGGCTTTTCCTGAAAGG + Intronic
967669437 3:192215192-192215214 CTTTCCTGGCTTTCCCTCGAAGG + Intronic
968130710 3:196191352-196191374 CCTGCCTGCCTTTTCCTGGCAGG - Intergenic
970047898 4:11876570-11876592 CTTACCTGGCTTTTCCTGAAAGG - Intergenic
970581553 4:17478159-17478181 CCTTCCTGTCTGTTCCTGGTGGG - Intronic
970609664 4:17713342-17713364 CATTGCAGGATCTTCCTGGAAGG - Intronic
975757799 4:77588173-77588195 CCTACCTGAATTTTCCTGGAGGG + Intronic
978159346 4:105527177-105527199 GTTTCCAGGCGTTTCCAGGAGGG + Intergenic
980941006 4:139273949-139273971 TCTTACAGGGTTTACCTGGAGGG + Intronic
984314572 4:178111250-178111272 CCTTCCCAGCTCTTCTTGGATGG + Intergenic
984338814 4:178427232-178427254 CCTCCCAGGCTTTTCTTTAAGGG - Intergenic
985884647 5:2668198-2668220 CCTTCGAGGCTTCACCTGCATGG + Intergenic
990504425 5:56430551-56430573 CCTTCCATTGTTTCCCTGGAGGG - Intergenic
991379082 5:65999762-65999784 CGTTTCAGACTTTTCCTTGAGGG + Intronic
993371954 5:87103477-87103499 CCTCCCAGTGTTTTCCTGGGGGG + Intergenic
993570842 5:89536937-89536959 CCTCCTGAGCTTTTCCTGGATGG + Intergenic
996679760 5:126219231-126219253 GATTCCAGGCTTTTCTTGGTTGG - Intergenic
997735581 5:136210267-136210289 CCTTCCAGGCTATAACTAGAAGG + Intergenic
998621872 5:143803144-143803166 TTTTCCATGCCTTTCCTGGAAGG + Intergenic
999060032 5:148623924-148623946 CCCTCCCGGATTTTCTTGGAGGG + Intronic
1002764385 6:226713-226735 CCATGCAGACTTTTCATGGAAGG + Intergenic
1002883894 6:1276726-1276748 TGTTCCAGGCTTTTCCTCGGTGG + Intergenic
1004554870 6:16686278-16686300 CCTTCCAGGTCTTTCCTAAAAGG + Intronic
1004731801 6:18366391-18366413 CCCTCCTGGCTTCTCCTGTAGGG - Intergenic
1004869359 6:19889134-19889156 TCTTCCTGGCTTTTCATGGTAGG + Intergenic
1006398856 6:33804162-33804184 GCTTCCAGGGCTTTCCTGGAAGG + Intergenic
1006783828 6:36651402-36651424 AAATCCTGGCTTTTCCTGGAAGG - Intergenic
1006941816 6:37756597-37756619 CCTTCCTGGATTTCCCAGGATGG - Intergenic
1008726090 6:54421694-54421716 CAGTCCAGGCTTTTCTTTGATGG - Intergenic
1009843818 6:69110928-69110950 CCTTTCATGATTTTCCTAGATGG - Intronic
1013412824 6:109897171-109897193 ACTTCCTGGCTTTTCAGGGAGGG + Intergenic
1017895227 6:158673732-158673754 CCTTCAAAGCTGTTCCTGGCGGG - Intronic
1018478954 6:164170954-164170976 CATTCCAGGCTATCGCTGGAAGG - Intergenic
1019733183 7:2638486-2638508 CCTTCCAGGCCATTCCTGGAGGG + Intronic
1022465105 7:30648364-30648386 GCTTCCAGGCTCTGCCTCGAAGG - Intergenic
1022552540 7:31254943-31254965 CCTTGAATGCTTTTTCTGGATGG + Intergenic
1023565384 7:41518963-41518985 TCTTCCAGGATTTTCCAGGGTGG - Intergenic
1023774219 7:43588527-43588549 CATTCTAGGTTTTTCCTGAATGG + Intronic
1024483845 7:49894088-49894110 GTTTCTAGGCTTTTTCTGGAAGG + Intronic
1027050354 7:75017878-75017900 CCTTCCACGCTATTCCAGGGTGG + Intronic
1027861892 7:83594554-83594576 CCTTCCTAGGTTTTTCTGGAAGG + Intronic
1028852696 7:95554029-95554051 CCTTACAGGCTTTTGCTGCTGGG - Intergenic
1029382680 7:100223773-100223795 CCTTCCACGCTATTCCAGGGTGG - Intronic
1029737698 7:102473763-102473785 CCCGCCAGGCCCTTCCTGGAGGG + Intronic
1030187273 7:106776296-106776318 CCTTCCAGGTTTTCCCTGGATGG - Intergenic
1031019864 7:116615490-116615512 CATTCCAAGAATTTCCTGGAAGG + Intergenic
1032018142 7:128392661-128392683 CCCTCCTGGCTTCTCCTGTAGGG - Exonic
1033097320 7:138442547-138442569 CCCTCCTGGCTTCTCCTGTAGGG + Intergenic
1033925837 7:146459236-146459258 CCTTCCATGGTTTTCCAAGAAGG + Intronic
1034738881 7:153454982-153455004 CCATCCAGGCATTTCCTGGGAGG - Intergenic
1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG + Intronic
1036580243 8:10067325-10067347 CCTTCATGTCTTTTCCTGGTTGG + Intronic
1036696816 8:10980200-10980222 CCTTCCTGCCTCTGCCTGGAAGG - Intronic
1037752341 8:21690998-21691020 CCTTCCAGCCTCTGCATGGAAGG - Exonic
1038216336 8:25564918-25564940 CCTTCCAGTCTCTTCTTGGCCGG - Intergenic
1038426538 8:27467706-27467728 CCGTGGAGGCTTTTCCTAGATGG - Intronic
1038455989 8:27672265-27672287 CCTTCCAGGCTGCTCCTGAAGGG - Exonic
1039490307 8:37942476-37942498 CCTTCCAGGTTCTTCCTGAAGGG + Intergenic
1039567273 8:38560389-38560411 CCTTCCGGGCTTTTCTTCCAGGG + Intergenic
1039708915 8:40036051-40036073 CCTCTCAGGCTTCACCTGGAAGG + Intergenic
1043160855 8:76844721-76844743 CCTTCCTGGGTTTTTCTGTAGGG + Intronic
1043394857 8:79826446-79826468 CCTGCCAGGATATTCCTGGTAGG - Intergenic
1047275576 8:123402424-123402446 CCCTCCTGGCTTCTCCTGTAGGG + Intronic
1047928105 8:129700856-129700878 CCTCCCATTCTTTTCCTGGGAGG + Intergenic
1048048998 8:130799615-130799637 CCTCCCAGGCATTTCCAGCAAGG - Intronic
1048378602 8:133844593-133844615 ACTTCCAGGCTTTCCTTGGAAGG + Intergenic
1049246424 8:141565222-141565244 CTTTCCAGGCCTTGCCTGGCAGG + Intergenic
1049309011 8:141923570-141923592 CCTCCCTGGCTTTCCCTGGCAGG + Intergenic
1050319970 9:4442075-4442097 AGTTCCAGGCTTTTCTTAGATGG + Intergenic
1056083970 9:83126493-83126515 CCTTACAGGTTTTCCCTTGAAGG + Intergenic
1057801902 9:98195914-98195936 CCTTCCCTGCTCTTTCTGGAGGG - Intergenic
1057817415 9:98305836-98305858 CCTTCCAGCCTTTTTCTTAATGG - Intronic
1058464535 9:105214581-105214603 CCTACCAGGCTGCTACTGGATGG - Intergenic
1059154379 9:111976929-111976951 CATACCAGGCTGGTCCTGGAGGG + Intergenic
1061076186 9:128342954-128342976 CTTTCCAGGCTTGGCCTGGAAGG - Intronic
1062190320 9:135244707-135244729 CCGTCAGGGCTTTGCCTGGATGG - Intergenic
1062361201 9:136189137-136189159 CCTTCCAGGGTTTTCCTACACGG - Intergenic
1189375713 X:40464995-40465017 GCTTCCAGCCTTTCCATGGATGG + Intergenic
1189658942 X:43277754-43277776 CCATCCTGGCTTCTCCTGTAGGG - Intergenic
1190632358 X:52400294-52400316 GCTCCCAGGTCTTTCCTGGAAGG + Intergenic
1192205081 X:69090252-69090274 CCTTCCCAGCTATGCCTGGAGGG - Intergenic
1193046986 X:77064064-77064086 GTTTCCAAGCTATTCCTGGATGG - Intergenic
1193753316 X:85374578-85374600 CCTTCCATGGTTTTCCTTCATGG - Intronic
1194576824 X:95623555-95623577 TCTTCCAGACCTTTTCTGGAGGG - Intergenic
1194724806 X:97382849-97382871 TCTACAAGGCTTTGCCTGGAGGG - Intronic
1195583089 X:106531142-106531164 CCTTCCATCCTTTTCCTAGTGGG - Intergenic
1196750777 X:119115629-119115651 CCCTCAAGGCTTTGCCTGGTTGG + Intronic
1200143976 X:153916437-153916459 CCTGCTAGGCTTTGGCTGGAGGG + Intronic
1202585598 Y:26422708-26422730 CCTTCCTGGCTCTTACTGGAAGG - Intergenic