ID: 923579296

View in Genome Browser
Species Human (GRCh38)
Location 1:235192433-235192455
Sequence TCCTACATGCAAATAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923579296 Original CRISPR TCCTACATGCAAATAGTGCA TGG (reversed) Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908754098 1:67451916-67451938 TCATACATACAAAAAGAGCAGGG - Intergenic
909291973 1:73894598-73894620 ACATACATGAAAATAATGCAGGG + Intergenic
910258298 1:85271969-85271991 TCCTACATGCAAAGGGCTCATGG + Intronic
910652651 1:89586500-89586522 TCATACATTTAAATAATGCATGG - Intronic
915331786 1:155117104-155117126 GCCTCCATGCAATTATTGCAGGG - Intergenic
923579296 1:235192433-235192455 TCCTACATGCAAATAGTGCATGG - Intronic
924062161 1:240186357-240186379 CCCCACATCCAAATAGTGCCTGG - Intronic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1065489748 10:26270791-26270813 TCCCACATGAAAAACGTGCAAGG - Intronic
1066663824 10:37762713-37762735 TGCTACATACAAATAGTTCCTGG + Intergenic
1068262875 10:54606035-54606057 GCCCACATGTAAATAGTGAATGG + Intronic
1072146878 10:92648874-92648896 TCCTAAATGCTAATGGTCCATGG - Intronic
1074919641 10:117993969-117993991 ACCTACATTCAAATGGTTCAGGG - Intergenic
1075834551 10:125442716-125442738 TCCAACATGCACATAGGGCTTGG - Intergenic
1078902240 11:15652116-15652138 TACTACCTGCAAATACTGCCAGG - Intergenic
1079275564 11:19033036-19033058 TCTTGCATGCAAAAAGGGCATGG + Intergenic
1080919213 11:36692086-36692108 TCTGACATGGAAATATTGCAGGG - Intergenic
1081863348 11:46346617-46346639 TCCTACATACAAATACTCCCAGG - Intronic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1091152560 11:133342427-133342449 TCCTACCTGTACATAGAGCAGGG + Intronic
1096973626 12:55685876-55685898 TCCTACATGCTCAGACTGCATGG + Intronic
1099438120 12:82667915-82667937 TCCTACATTCAAATAGTACCTGG + Intergenic
1099970807 12:89498585-89498607 TTTTACATGGAAATAATGCATGG - Intronic
1100744565 12:97631700-97631722 TCCTGCAGGCAAAGGGTGCAAGG - Intergenic
1107186338 13:37525885-37525907 TCCTACATTCAGATATTGCTAGG + Intergenic
1110126985 13:71956147-71956169 TTAAACATGTAAATAGTGCAAGG - Intergenic
1110389560 13:74958368-74958390 TCCTACCTGGAAATTATGCACGG + Intergenic
1111697784 13:91647249-91647271 TGCTTCATGGAAAAAGTGCATGG + Intronic
1114178318 14:20343495-20343517 AGCGACATGCAAATATTGCAGGG + Intergenic
1116660846 14:47708728-47708750 TTCTCCATGCAAAAATTGCAAGG + Intergenic
1117740027 14:58808095-58808117 TGCTATAAACAAATAGTGCATGG + Intergenic
1118387761 14:65270612-65270634 TGCTTCATGCAAAGAATGCACGG - Intergenic
1125033572 15:35097391-35097413 TTCACCATGAAAATAGTGCACGG + Intergenic
1128156061 15:65392583-65392605 TTCTACAAGCACAGAGTGCAGGG + Intronic
1128743791 15:70099835-70099857 TCCCGCTTGCAAATAGTGCTTGG + Intergenic
1131374729 15:91914248-91914270 TCCTACATGGCAGGAGTGCATGG - Intronic
1134183870 16:12067974-12067996 TCCTAAATGCACTTAATGCAGGG + Intronic
1134815941 16:17206066-17206088 TCCTAAATCCACACAGTGCAAGG - Intronic
1136087925 16:27898872-27898894 TCCCACATGGAAATAGTGGCTGG + Intronic
1142297129 16:89231660-89231682 TCCTACAGGCAAGGGGTGCAGGG - Exonic
1147951326 17:44109546-44109568 TCCTACATGAGAAAACTGCATGG + Intronic
1154993931 18:21622044-21622066 TCCTACATACCCACAGTGCAGGG + Intronic
1159459458 18:68705255-68705277 TCCAAAATGTCAATAGTGCAAGG + Intronic
1159761991 18:72438534-72438556 TGTTACATGCATATATTGCATGG + Intergenic
1166673060 19:44722990-44723012 TACTAGGTGTAAATAGTGCAGGG + Intergenic
928808606 2:35193915-35193937 TCCTACATGGGAAAACTGCATGG - Intergenic
940577330 2:155526935-155526957 TCCTATATACAAATAGTGGCAGG - Intergenic
940591664 2:155736420-155736442 ACATACATGCAAATAGTGCCAGG - Intergenic
943466692 2:188237152-188237174 TTCTACATGCAAGTTGTGTAAGG + Intergenic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
944923968 2:204443984-204444006 TGCTACATGCAAATGGGGCAAGG - Intergenic
945445537 2:209933472-209933494 TCCAAGCTGCAAATAGTGCTTGG + Intronic
946140579 2:217687262-217687284 CCCTACATGCAAACACTGAAAGG + Intronic
1168861209 20:1047271-1047293 ACCTGCATGCAAATAGGGCTGGG - Intergenic
1169342964 20:4810217-4810239 TCCTTCATGCAACTGCTGCAGGG - Intronic
1169742515 20:8910453-8910475 TACTACATGAAAAAATTGCATGG - Intronic
1170205950 20:13798806-13798828 TCCTACTTGCAAAAAGTTTATGG - Intronic
1170742783 20:19072762-19072784 TCCTACATGCAATTGTTTCAGGG - Intergenic
1177703908 21:24674943-24674965 TCCTGCCTGCAAAGAGTTCAGGG + Intergenic
1178403104 21:32304112-32304134 TCCTTCCTAAAAATAGTGCAGGG - Intronic
1180051326 21:45332212-45332234 TCCTCACTGTAAATAGTGCAAGG - Intergenic
949143250 3:662380-662402 TCCTTCTTGCAGATAGTGGAGGG + Intergenic
949487929 3:4558251-4558273 TACTAATGGCAAATAGTGCAAGG + Intronic
951091199 3:18575900-18575922 TTCTATATGCAAAAACTGCATGG + Intergenic
960169866 3:114447547-114447569 TCTGAAATGCAAACAGTGCAGGG - Intronic
961703591 3:128766101-128766123 TCCAACATACAAATTTTGCAGGG + Intronic
962420309 3:135222552-135222574 TCTTTCATGCAAATAGTGGCCGG + Intronic
964531440 3:157672258-157672280 TCCTAGATGCCAAGAATGCAGGG - Intronic
969257169 4:6010124-6010146 TCCTACATTCACATAGGGCATGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
973857918 4:55032174-55032196 TACTACATGGAAGAAGTGCAAGG - Intergenic
974490801 4:62561448-62561470 TCCAAAAGGCAAATAATGCAAGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978476135 4:109132854-109132876 TTCTACTTGCAAATACTGAATGG + Intronic
982995149 4:162334628-162334650 TCCTACATGCAAAGATTTTAAGG + Intergenic
984275465 4:177604471-177604493 TCCTATAGACAAATAATGCAAGG - Intergenic
985166898 4:187105544-187105566 TCATACATGGCAATAGTTCAAGG - Intergenic
986121594 5:4842729-4842751 TCATATATGCATATAGTGCCTGG - Intergenic
995862717 5:116659270-116659292 TTGTTCATGCCAATAGTGCAGGG - Intergenic
1007354644 6:41304992-41305014 ACCTACCTGCAAAGGGTGCAAGG - Intergenic
1016192052 6:141281337-141281359 TCCTACACACACATAGTGAAAGG + Intergenic
1020504752 7:8970626-8970648 TCCTACATAATCATAGTGCAAGG + Intergenic
1022146875 7:27552776-27552798 TCCTACTTGCTAATAGGACAAGG + Intronic
1028796984 7:94913968-94913990 TACTAAATGCATATAGTGAAAGG + Intronic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1035345855 7:158197408-158197430 TCCTACATGGAAACAGTACCTGG - Intronic
1037255996 8:16954379-16954401 TCTTACATGCACATATTGCCTGG - Intergenic
1041700235 8:60780682-60780704 GCCTACATGAAAATGGTGAATGG - Intronic
1043224892 8:77713701-77713723 TGCTACATGCATATATTGCATGG + Intergenic
1044536154 8:93358389-93358411 TATTACATACAAATAATGCATGG + Intergenic
1045595922 8:103656506-103656528 TCCTACTCTCAAATAGTTCATGG + Intronic
1049433044 8:142574113-142574135 TCCCACATCCAAACACTGCATGG - Intergenic
1051691212 9:19714574-19714596 TCCTCCATACAAATAGTGAAGGG - Intronic
1052987849 9:34501326-34501348 TCCTACTGGCAATTAGTGCTGGG + Intronic
1055864823 9:80800461-80800483 TACTACATGTAAAAAATGCAAGG + Intergenic
1056832018 9:89924836-89924858 TCCTCCAGGCAGATACTGCAGGG - Intergenic
1057244004 9:93438907-93438929 TCCTTCATGTAAATAGTGTTTGG + Intergenic
1057666844 9:97052665-97052687 CCCAACATGTAAATAGTGCACGG - Intergenic
1058907926 9:109496863-109496885 CCCTAAATGTCAATAGTGCAAGG + Intronic
1059864813 9:118502502-118502524 TGTTACATGCATATATTGCATGG + Intergenic
1060367077 9:123027849-123027871 TCCTACATGAAAATAGTGGCTGG + Intronic
1060481629 9:124019452-124019474 TCCAAAATGCAAATATTGCCGGG - Intronic
1060841786 9:126799273-126799295 TTCAACATGCAAATATTGGAGGG + Intergenic
1186029722 X:5354609-5354631 TGCTACATGCATATATTGCATGG + Intergenic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1190361336 X:49651946-49651968 TTCTATATGCAAAGTGTGCAAGG - Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193113068 X:77749002-77749024 TCGTACATGCATATATTGCATGG + Intronic
1194551413 X:95305152-95305174 TCCTACATGGTCATAGTGCATGG - Intergenic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1195719865 X:107856803-107856825 TGCCACATGCAAATAGAGTAAGG + Intronic
1197072071 X:122311582-122311604 TCCTACACCCAAATTATGCACGG + Intergenic