ID: 923580028

View in Genome Browser
Species Human (GRCh38)
Location 1:235200788-235200810
Sequence TAGTCAATGCAGATAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923580026_923580028 10 Left 923580026 1:235200755-235200777 CCAAATTTACCTTAGACATAATA 0: 1
1: 0
2: 1
3: 22
4: 223
Right 923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG 0: 1
1: 0
2: 1
3: 31
4: 331
923580027_923580028 1 Left 923580027 1:235200764-235200786 CCTTAGACATAATAGATAAGAAA 0: 1
1: 0
2: 1
3: 49
4: 653
Right 923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG 0: 1
1: 0
2: 1
3: 31
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923580028 Original CRISPR TAGTCAATGCAGATAGAAAA TGG Intronic
903138337 1:21323775-21323797 TAGTGAAGGGAGACAGAAAATGG + Intronic
904243667 1:29169567-29169589 TAGTCTAGGAAAATAGAAAAAGG + Intronic
907976511 1:59436185-59436207 AAGTCAGTGCAGATAGAAAGGGG - Intronic
908030925 1:59998616-59998638 TAAACTATGCAGATAGAACATGG - Intronic
908682705 1:66680158-66680180 TAGTCTATGAAGACATAAAATGG + Intronic
908912289 1:69086018-69086040 TAGCCAAAGCAGAAAGGAAATGG - Intergenic
908948527 1:69529126-69529148 TGATCAATGTAGAGAGAAAATGG - Intergenic
908983175 1:69983603-69983625 CAGTCAATGCAGGTATATAAAGG + Intronic
911860410 1:102940424-102940446 TATTCAATACAGGGAGAAAAAGG - Exonic
912023848 1:105141238-105141260 TAGTAAATATAGATTGAAAAGGG + Intergenic
912190146 1:107329118-107329140 TAAACAATGGAGGTAGAAAAAGG - Intronic
915864864 1:159488315-159488337 TTGTTAATGCAGAAAGATAAGGG - Intergenic
916380659 1:164207355-164207377 TAATTTATGCAGATAGAAATCGG + Intergenic
916696283 1:167240228-167240250 TAGTCAATTCATGTAGAATAAGG + Intronic
917063134 1:171062785-171062807 TAGTCTATTAAGAAAGAAAAAGG - Intronic
917366703 1:174239335-174239357 TAGTGAATGAAGACAGAGAAAGG - Intronic
918893225 1:190303419-190303441 TATTCAATAAAGATTGAAAAAGG + Intronic
919011240 1:191967538-191967560 TAGAGAAGGCAGATACAAAAAGG + Intergenic
919338935 1:196278594-196278616 TTGACATTGCAGATAGGAAAAGG - Intronic
920005668 1:202832095-202832117 CAGTCCATGGAGAAAGAAAAGGG - Intergenic
923345835 1:233051693-233051715 TAGACATTGCAGGTAGAAAAGGG + Intronic
923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG + Intronic
923850850 1:237792642-237792664 TAGTCAATGTAGACATAAAAAGG - Intronic
1066203990 10:33169664-33169686 TATTCAGTGCAGAAGGAAAAAGG + Intergenic
1066271033 10:33823709-33823731 AAGTCAATGCATTTAGAGAAGGG + Intergenic
1067194526 10:44104592-44104614 TATTAAAAGCAGATACAAAATGG + Intergenic
1068092886 10:52454687-52454709 AAGTGAATGTAAATAGAAAAGGG - Intergenic
1068144854 10:53055251-53055273 TAGACAATGCATAATGAAAAAGG - Intergenic
1068642085 10:59421033-59421055 TAGTCAATGATGAAAGAAATTGG + Intergenic
1069609146 10:69761051-69761073 TAGTCCCTGCATATAGTAAATGG + Intergenic
1073671447 10:105594830-105594852 TAGTCACTGAAGAGTGAAAAGGG - Intergenic
1074348983 10:112716556-112716578 TAGCCAATGAAGAGAGAACAGGG + Intronic
1074957238 10:118404116-118404138 CAGTTAATGCTGTTAGAAAATGG + Intergenic
1078243369 11:9550826-9550848 TAGTTAATGCAATTAGACAATGG + Intergenic
1078967627 11:16364762-16364784 TTGTAAATCCAGTTAGAAAAGGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079661102 11:23037537-23037559 AAATGAATCCAGATAGAAAAGGG + Intergenic
1080315572 11:30944321-30944343 TAGGCAATGCAGACAGAGCAAGG - Intronic
1080427186 11:32166749-32166771 GATTCAATGGAGATGGAAAAGGG + Intergenic
1080611568 11:33908723-33908745 CAGACAATGCAGAAAGAAACTGG + Intergenic
1081463927 11:43299102-43299124 TCTTCTCTGCAGATAGAAAAAGG + Intergenic
1081509076 11:43750051-43750073 TAGTAAAAGTAAATAGAAAATGG - Intronic
1082189659 11:49227467-49227489 GAGTGAATGCTGATAGAGAAAGG - Intergenic
1083995827 11:66271780-66271802 TAGTCACTGGAGAGAGAAGATGG - Exonic
1085852212 11:80134610-80134632 GAATCAATGAAGAAAGAAAAAGG - Intergenic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1086676867 11:89619033-89619055 GAGTGAATGCTGATAGAGAAAGG + Intergenic
1087252308 11:95916534-95916556 TAGTCAATACAGATCTAATATGG - Intronic
1087677883 11:101183372-101183394 TAGGAAATGCAGTTACAAAATGG + Intergenic
1088323256 11:108574863-108574885 TATTCGAGGCAGAAAGAAAAAGG - Intronic
1089717987 11:120382732-120382754 TAACCAATGCACATATAAAAAGG - Intronic
1090433522 11:126666726-126666748 TAGTCAATACAAATAAAAATGGG - Intronic
1090460024 11:126882726-126882748 TAGTCATTGCAGGCACAAAAGGG - Intronic
1091921727 12:4310095-4310117 AAGTCAATGAAGAAAGTAAAGGG + Intergenic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092903964 12:13085500-13085522 TAGGCACACCAGATAGAAAAGGG - Intronic
1093371556 12:18372641-18372663 TAGTCACTGAAAATAAAAAAAGG + Intronic
1094561407 12:31557059-31557081 TAGATAATGTAGATATAAAATGG + Intronic
1096286817 12:50307543-50307565 TAGTCAATGGCTAAAGAAAAAGG - Intergenic
1096873470 12:54609416-54609438 TAGTCATTGGAGATAGGAATGGG - Intergenic
1097693154 12:62753110-62753132 TAGGGAATGCATACAGAAAAAGG + Intronic
1098205494 12:68104957-68104979 TAGTCAATACAGAGAGAAGCAGG - Intergenic
1099582570 12:84469683-84469705 TAGACAATGGAGATTCAAAAGGG + Intergenic
1099628644 12:85110804-85110826 TAGTCTATTCAGATGTAAAATGG + Intronic
1099710774 12:86221757-86221779 TAGTATTTGTAGATAGAAAAAGG - Intronic
1100869876 12:98898925-98898947 TAGTCCTTTCTGATAGAAAATGG - Intronic
1101276788 12:103211012-103211034 CAATCAATCCAGATGGAAAAAGG - Intergenic
1101706962 12:107229812-107229834 TAGTCATTGGAGTTAGATAAGGG - Intergenic
1102509062 12:113402113-113402135 CAGTTAATTCAGATAGACAAGGG - Intronic
1104208425 12:126663010-126663032 CAGTAAACGGAGATAGAAAAGGG + Intergenic
1107290733 13:38850404-38850426 AAGTTAATGCAGATACCAAAAGG - Intronic
1108807378 13:54175884-54175906 TAGTGAGTGGAGAGAGAAAAGGG + Intergenic
1108957005 13:56171445-56171467 TAATCAGTGCACATATAAAACGG - Intergenic
1109073270 13:57798249-57798271 TAGTCACTGAAGAAAGAAAAAGG - Intergenic
1109420043 13:62100068-62100090 AAGTGAATGCAGATACAAAAGGG + Intergenic
1110079784 13:71295677-71295699 TGGTAAATGAAGAAAGAAAATGG - Intergenic
1110425010 13:75357238-75357260 TATCCAATGGAAATAGAAAAAGG + Intronic
1110934405 13:81267566-81267588 TTGTGAATGCACTTAGAAAAAGG - Intergenic
1111255651 13:85664009-85664031 TAGTAAATGCATACAGAAATGGG - Intergenic
1111776379 13:92668184-92668206 TAGTCAATACTGAGAGCAAAAGG - Intronic
1112028634 13:95436897-95436919 AAGTCAATGAAGAATGAAAATGG + Intronic
1112385601 13:98936663-98936685 CAGTCAATGGAGACAGAAATAGG + Intronic
1112553220 13:100442615-100442637 TAGACTCTGCAGATAGAACAAGG + Intronic
1112615989 13:101006043-101006065 AAGAAAATGCAGATAGAAACTGG - Intergenic
1113364337 13:109662054-109662076 GTGGCAATGCTGATAGAAAATGG + Intergenic
1114719772 14:24868792-24868814 TAGTAAAAACAGAGAGAAAAGGG + Intronic
1115476185 14:33815152-33815174 TATTCAATGGAGAAAGAATAAGG + Intergenic
1116307623 14:43278400-43278422 GAGTCAATGAAAATAAAAAAAGG - Intergenic
1116995040 14:51314393-51314415 TAGTCATTGCAGAGACAATAAGG + Intergenic
1117908866 14:60617207-60617229 AAGTCTATATAGATAGAAAATGG + Intergenic
1118067908 14:62212117-62212139 TAGTAAGTGCACATAGACAAAGG + Intergenic
1118269453 14:64328726-64328748 TACTCAAGGCAGACAGCAAAGGG + Intronic
1120027302 14:79600863-79600885 AAGAAAATGCAGAAAGAAAAAGG + Intronic
1120099944 14:80433763-80433785 TAGTCAATGTAAATACAACACGG - Intergenic
1120268734 14:82283515-82283537 TATTGAATGCATAAAGAAAAGGG + Intergenic
1120557612 14:85948353-85948375 TAATCAAGGCAGATGGAAACAGG + Intergenic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1120661467 14:87256221-87256243 TATTCAAAGCAGATAGCAGAAGG + Intergenic
1120816617 14:88866579-88866601 TAGTCAATGCAGCTGGAACTTGG - Intronic
1121480099 14:94260473-94260495 TAGACAATGTAGATGTAAAATGG - Intronic
1124970196 15:34481586-34481608 TAGTCAATACTGAGAGCAAAAGG - Intergenic
1126654098 15:50957119-50957141 GAGTGAGTGCAGATACAAAAGGG - Intronic
1126740786 15:51774294-51774316 TTTAAAATGCAGATAGAAAAAGG + Intronic
1126759925 15:51960733-51960755 TCTTCAATGCAGAAGGAAAAAGG + Exonic
1127027756 15:54826405-54826427 TAGTCAATGAAGAAAGTAAAAGG - Intergenic
1127978083 15:64013896-64013918 TAGTCATTTCACTTAGAAAATGG + Intronic
1128595425 15:68942426-68942448 TAGTCAATGCAATTAGATGAGGG - Intronic
1131344712 15:91635719-91635741 TACACAATACAGCTAGAAAATGG + Intergenic
1131748586 15:95479451-95479473 TACTCTAGGCAGATAGAAAAAGG - Intergenic
1132189157 15:99834414-99834436 TAGTCAATACTGAGAGCAAAAGG + Intergenic
1137684556 16:50377211-50377233 TAGGGAAGGCAGATAGAAAGAGG - Intergenic
1138036301 16:53610070-53610092 TGGGCAATGGAGACAGAAAAGGG + Intronic
1139454394 16:67060884-67060906 AAGTGAATGAAGCTAGAAAAAGG - Intronic
1139516062 16:67453046-67453068 TGGTCAGAGCAGATAGAGAATGG + Intronic
1141339031 16:83185947-83185969 TAGACAATACAGAAACAAAAAGG - Intronic
1143996397 17:11010150-11010172 TAGTCATGGCTGATAGAACAGGG - Intergenic
1144953655 17:19007352-19007374 TAGACAATCCATTTAGAAAATGG - Intronic
1147545870 17:41401434-41401456 TATTCAGTGTAAATAGAAAACGG + Intergenic
1149918894 17:60637672-60637694 GATTGAGTGCAGATAGAAAAGGG + Intronic
1151736816 17:75947614-75947636 TAGTCATTGCTGCTAGACAAAGG + Intronic
1153079191 18:1201240-1201262 AAGTAAATGCAGAGAGAAAGGGG - Intergenic
1153513878 18:5886737-5886759 TAGTAAATGGAGATAATAAATGG - Exonic
1155400188 18:25429652-25429674 TAGCCAATGCAGTTAGGAATGGG + Intergenic
1156311647 18:35927869-35927891 TAGTCAATGCCTATAGATAAGGG + Intergenic
1156466077 18:37348535-37348557 AAATCCAGGCAGATAGAAAATGG - Intronic
1156588319 18:38457622-38457644 ATGCCAATGCAGAGAGAAAAGGG + Intergenic
1156677372 18:39545202-39545224 TACAAAATGCAGACAGAAAAGGG - Intergenic
1156811312 18:41255813-41255835 TAATCAATGCAGCTATAAGAAGG + Intergenic
1156906551 18:42359629-42359651 TATTCAATGCAGGTAGGAAGTGG + Intergenic
1158559047 18:58498538-58498560 TAGTCAATGCCAATAGCAAGAGG + Intronic
1160312035 18:77802913-77802935 AAGACAATGCTGATGGAAAAGGG + Intergenic
1164219465 19:23180211-23180233 GAGTCAATTCAGGTGGAAAAAGG + Intergenic
1166419853 19:42628156-42628178 TAGGCTATGAAGATAGAAAAAGG - Intronic
925846841 2:8042620-8042642 AAGTCACTGCAGGTAGAGAAAGG + Intergenic
926213907 2:10891723-10891745 GAGTCAGTGCAGATGGAAACAGG + Intergenic
927271656 2:21216668-21216690 TAGTCAATGTAGCTAAAACATGG + Intergenic
927328995 2:21840740-21840762 CAGTCATGGCAGATAGTAAAGGG - Intergenic
929282695 2:40099702-40099724 TAGTCAATCCATAAAGAAAAGGG - Intronic
929486217 2:42357273-42357295 GAGTCACTGCAGATTGAAACTGG - Intronic
929498469 2:42468183-42468205 TAGTCACTGCAGCAAGACAAAGG + Intronic
930449579 2:51518370-51518392 TAGCAAATGAAGATAAAAAAAGG + Intergenic
931798152 2:65731764-65731786 TAGACATGGCAGCTAGAAAATGG - Intergenic
931925160 2:67064567-67064589 TAGTCAATGAAGTTTGAAAAGGG - Intergenic
932515425 2:72342989-72343011 TGGTCAATGGAGAAAGAAAATGG + Intronic
932965268 2:76467062-76467084 TTGACAATGCACATATAAAATGG + Intergenic
933343217 2:81048876-81048898 TAGTCAAAACAATTAGAAAAAGG - Intergenic
933854085 2:86396494-86396516 TTGTCTATGCAAATAGAAACGGG - Intergenic
934124302 2:88871474-88871496 TAGTCAAAGGAGAAAGAAAGGGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934873295 2:97887895-97887917 TACTGAATGCAGTTTGAAAATGG - Intronic
937075509 2:119102843-119102865 TAGATATTGCAGATAGAAAAGGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937777728 2:125799796-125799818 TGGCCAATGCATATACAAAAAGG + Intergenic
938232826 2:129676387-129676409 TAAACAATTCAGTTAGAAAATGG - Intergenic
939062396 2:137438518-137438540 TAGGCAATGCAGAAATAAATGGG + Intronic
941297859 2:163762560-163762582 TAGTCAATACAAAAAGAAAAAGG - Intergenic
942801788 2:179883942-179883964 CAGACAATGCTGATAAAAAAGGG + Intergenic
943061120 2:183042532-183042554 AATTGAATGCAGAAAGAAAAAGG + Intergenic
943433126 2:187828879-187828901 TAGCCAAGGCAGTTACAAAAAGG + Intergenic
944320699 2:198338633-198338655 CAGTCAATTCACATAGAAGAAGG + Intronic
944594564 2:201249202-201249224 TAGTCAATCTAAATATAAAAAGG - Intronic
944805473 2:203276878-203276900 TAGTGAATATAGATAGAAAAAGG + Intronic
944907078 2:204272650-204272672 TAGTCAATTAAGAGAGAAGAAGG + Intergenic
944920670 2:204409815-204409837 TAGTCCATGCAATTAGTAAAAGG - Intergenic
944926487 2:204470467-204470489 TTGTAAAAGTAGATAGAAAAGGG + Intergenic
945000434 2:205344578-205344600 TAGGGAATGCCCATAGAAAAGGG - Intronic
945882175 2:215336937-215336959 AAGTCTCTGCAGTTAGAAAATGG + Intronic
947126552 2:226874595-226874617 TATTTAACACAGATAGAAAAAGG - Intronic
947997810 2:234543676-234543698 TAGCCAAGTCAGAGAGAAAATGG + Intergenic
948287570 2:236798365-236798387 AAGGCATTGCAGAAAGAAAATGG - Intergenic
948573547 2:238934724-238934746 AAATCAATTCAAATAGAAAATGG + Intergenic
948815100 2:240506447-240506469 TAGTCTATCCAGACAGAACAGGG + Intronic
1169761727 20:9102317-9102339 TAGCCAATGAAGATGGAAAGAGG + Intronic
1169839637 20:9920719-9920741 TAGCAAATGCAAATAGAAATTGG + Intergenic
1170292139 20:14782587-14782609 TGGTTAATGCAGATATGAAAAGG + Intronic
1170597110 20:17814421-17814443 CAGTCAGTGCAGATAAAAATGGG + Intergenic
1177490411 21:21818258-21818280 TAGGCAATGAACATAGAAAAAGG + Intergenic
1177744297 21:25192639-25192661 TAGTCCATGCAGGTGTAAAAAGG + Intergenic
1178449301 21:32679998-32680020 TAGTCACTGCAGAAATGAAAAGG + Intronic
1183138262 22:35911394-35911416 TAATCAATGCATATGGGAAATGG + Intronic
1185147298 22:49146114-49146136 TAGTCAATCCCCATGGAAAAAGG + Intergenic
951124568 3:18968479-18968501 TAGTCAATCAAGATAGAAGCTGG + Intergenic
951305815 3:21060235-21060257 AAGTGGATGCAAATAGAAAAGGG + Intergenic
951418319 3:22451882-22451904 AAGACTATGCAGAAAGAAAAAGG + Intergenic
951489669 3:23255570-23255592 GAGTCAAAGTAGAGAGAAAAAGG + Intronic
952515977 3:34105103-34105125 TAGTGAGTGCTGAGAGAAAATGG + Intergenic
953491101 3:43351813-43351835 GAGTCACTGCAGATAGAGCAGGG - Intronic
953572358 3:44081222-44081244 TAGTCAAGGCAGGCAGAAAATGG + Intergenic
954309396 3:49753131-49753153 AAGTGAAGGCAGAGAGAAAATGG - Intronic
955308302 3:57857271-57857293 TATTCCCTGCAGATAGGAAATGG - Intronic
956368442 3:68531953-68531975 TAGTCAATGCAATAATAAAAAGG - Intronic
956582107 3:70825580-70825602 TTGTCAATGTAGATTGGAAAGGG - Intergenic
956730280 3:72190153-72190175 TAGTCAATGCAGAGGTACAAAGG + Intergenic
957554418 3:81748150-81748172 AAATCAATCCAGTTAGAAAATGG + Intronic
957585956 3:82132288-82132310 TAGTTAATGCCAAGAGAAAAAGG + Intergenic
958122439 3:89308843-89308865 TACTGAATGCATATATAAAATGG + Intronic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
958968138 3:100581670-100581692 TGGCTAATGAAGATAGAAAAAGG + Intergenic
959128737 3:102324317-102324339 TAGTCAAAGCTGAGAGAAAGAGG + Intronic
959144401 3:102526670-102526692 AAGTCAATCCAGGTAGCAAATGG - Intergenic
959433853 3:106288265-106288287 GAGCCAATGCAGAGAGAAGAGGG - Intergenic
960230951 3:115226760-115226782 TAGTCAATACATGTATAAAAAGG - Intergenic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
960600068 3:119448269-119448291 TAGTTCATTCAGAAAGAAAATGG - Intronic
960863574 3:122178289-122178311 TAGTCAATAAACATTGAAAAAGG + Intergenic
961417951 3:126775040-126775062 TACACAAAGCAGATATAAAAAGG - Intronic
962443029 3:135440212-135440234 TAGAAAATGCAGATAAGAAAAGG - Intergenic
963224685 3:142850403-142850425 GAGTGAATGTGGATAGAAAAAGG + Intronic
963405052 3:144853261-144853283 TAGTCATTGCAGAAGGACAAAGG - Intergenic
963660478 3:148121077-148121099 AAGACAAAGGAGATAGAAAACGG + Intergenic
964291399 3:155185027-155185049 TAGTAAATGAAAATAGAAAAAGG + Intergenic
964886845 3:161493352-161493374 AAATCAGTGCAGATAAAAAAAGG - Intergenic
966271212 3:178108238-178108260 GAGTCACTGCAAATAGAAGAAGG + Intergenic
966480040 3:180397222-180397244 AAGTCAATGTAGAAAAAAAAAGG + Intergenic
967695267 3:192523934-192523956 TCCAAAATGCAGATAGAAAAAGG + Intronic
967813394 3:193779528-193779550 TGGTCAATGCAGATGCAGAACGG + Intergenic
968254596 3:197255877-197255899 TAGTGATTGCAGTTATAAAAAGG + Intronic
968329936 3:197859355-197859377 TAGGCAATGCATAAACAAAAGGG - Intronic
968378466 4:65799-65821 CAGTCATGGCAGAAAGAAAAGGG - Intronic
968547083 4:1204879-1204901 GAGACAATGAAGAAAGAAAAGGG - Intronic
970425151 4:15938942-15938964 TAGTAACTTCAGATGGAAAAAGG - Intergenic
970885858 4:20986892-20986914 TAACTAATGCAGATAGGAAAGGG - Intronic
972198629 4:36685346-36685368 TAGACACTGCAGAAAGAAAGAGG - Intergenic
972435377 4:39028773-39028795 TAGATAATGGAGATACAAAAGGG - Intronic
973004689 4:44992565-44992587 TAGATAATCCAGATAGAATATGG + Intergenic
974201976 4:58654423-58654445 TAATTAATGCTGATATAAAAAGG + Intergenic
974631661 4:64498530-64498552 AAATCAATTCAGATTGAAAAAGG - Intergenic
975797509 4:78024316-78024338 TAGCCAATACACATACAAAAAGG - Intergenic
977224788 4:94383022-94383044 GAGTCAATGAAGAGAGATAAGGG + Intergenic
977745050 4:100536725-100536747 TTGTAAATGGTGATAGAAAAAGG - Intronic
978141932 4:105327707-105327729 TAGTCAATTCAAATGGCAAAGGG + Intergenic
978446367 4:108784175-108784197 TATTCAATGCATGGAGAAAATGG - Intergenic
978660329 4:111118793-111118815 TAGCCAATGAACTTAGAAAAAGG + Intergenic
978975643 4:114867113-114867135 TATTCATTGTAGAGAGAAAATGG - Intronic
980740000 4:136938082-136938104 TAGTAAATGCAGATATAAATTGG - Intergenic
981280103 4:142947233-142947255 AAATCAATCCAGTTAGAAAAAGG + Intergenic
981470903 4:145133333-145133355 TAGTCATTGCAGAAAAAAAATGG + Intronic
981971902 4:150673684-150673706 TAGTCAATAAATATAGATAAAGG - Intronic
982590081 4:157297577-157297599 CAATAAATCCAGATAGAAAATGG + Intronic
982592483 4:157332400-157332422 TTGTCAATGCAGAAGGAATATGG - Intronic
983403515 4:167295943-167295965 TAGTCAATACATATGTAAAAAGG - Intergenic
983722102 4:170868340-170868362 TAGTCATAGCAGAAAGAAAAAGG + Intergenic
984124376 4:175788145-175788167 TAGTCAAGGCAAATGGAAAGGGG + Intronic
984376908 4:178943227-178943249 TAGTTAATGCTGAAAGAAATGGG - Intergenic
984508377 4:180649441-180649463 TATACAATGCAGATACAAGAAGG + Intergenic
984685280 4:182660054-182660076 TATTCAATGCAAATATACAAAGG + Intronic
987996984 5:25295170-25295192 GAATCAATGCAGAAAGAAAACGG + Intergenic
988118779 5:26932576-26932598 TAATCAAAGAAGATAGAACAAGG - Intronic
988364406 5:30277365-30277387 TAGACATTGCAAATAGAAAGTGG + Intergenic
989335423 5:40310878-40310900 TAGGAAATGCAGAGAGAAATTGG - Intergenic
989658678 5:43774444-43774466 TCCTCAATGGGGATAGAAAAAGG + Intergenic
990131078 5:52584702-52584724 TAGCAAAAGCAGAAAGAAAAAGG + Intergenic
990549215 5:56856223-56856245 AAGTCAATACAGATAGAATCTGG - Intronic
991566755 5:68012861-68012883 AAGGAAATGCAGATACAAAAAGG - Intergenic
991729127 5:69566187-69566209 TATTCAAGGCAAAGAGAAAAAGG + Exonic
991805559 5:70421336-70421358 TATTCAAGGCAAAGAGAAAAAGG + Intergenic
991865826 5:71061687-71061709 TATTCAAGGCAAAGAGAAAAAGG - Exonic
992840121 5:80680735-80680757 TAATCAAGGGAGAGAGAAAAGGG - Intronic
992849457 5:80791671-80791693 TATTAAATCCAGATAGTAAATGG + Intronic
993245236 5:85442686-85442708 TAGTAAAAGCAGGGAGAAAAGGG + Intergenic
993282080 5:85938013-85938035 TATTGATTGAAGATAGAAAATGG + Intergenic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
994628633 5:102253465-102253487 TAGACACTGCAGATACAAGAGGG + Intronic
994677504 5:102843669-102843691 AAATCAATCCAAATAGAAAATGG + Intronic
994870395 5:105341714-105341736 TAGTATATGCACAAAGAAAAAGG - Intergenic
995178537 5:109207810-109207832 TTGCCAGTGCAGATACAAAACGG + Intergenic
995340341 5:111051481-111051503 CAGTCAATTCAGATACCAAAGGG - Intergenic
997380695 5:133434715-133434737 TAGCCAATGAAAATATAAAATGG - Intronic
997478237 5:134162009-134162031 TAAACAATGCTGAGAGAAAATGG + Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
1000109459 5:158093990-158094012 GAGTGAATGTAGATAGAAGAAGG - Intergenic
1000710186 5:164564904-164564926 AAGTAAAAGCAGATATAAAAGGG - Intergenic
1002756693 6:167464-167486 TAGCTAATGCAGAAAGCAAATGG - Intergenic
1003321125 6:5052815-5052837 TAGAGAGTGCAGGTAGAAAAAGG - Intergenic
1003780724 6:9422503-9422525 TAGCTAATGCAATTAGAAAAGGG + Intergenic
1003997707 6:11559682-11559704 AAGTCATTGCTGTTAGAAAATGG + Intronic
1008308886 6:49940464-49940486 TATTCTTTGCAGATAGAAATAGG + Intergenic
1009270673 6:61609656-61609678 TGGTCAATGGAACTAGAAAAGGG + Intergenic
1009534014 6:64857684-64857706 TAGTAAATCCATATGGAAAATGG - Intronic
1010374725 6:75153943-75153965 TAGTCATTAAAAATAGAAAACGG + Intronic
1011395807 6:86905756-86905778 CACGCAATGCAGAAAGAAAATGG - Intergenic
1011415392 6:87114232-87114254 TGATCAATGTAGAGAGAAAAAGG + Intergenic
1012175534 6:96077570-96077592 CAATCAATCCAGATGGAAAAAGG - Intronic
1012562744 6:100604833-100604855 TCTTCAATGCAGTTAGAATATGG + Intronic
1012668663 6:102012301-102012323 TACTCAATTCAAATAAAAAAAGG - Intronic
1013366780 6:109443046-109443068 TAGTCAATGCGGACACCAAAGGG - Exonic
1013752759 6:113426229-113426251 GAGTAATTGCAGAGAGAAAATGG - Intergenic
1014618066 6:123628943-123628965 TAGGCATTGCATTTAGAAAAAGG - Intronic
1015458538 6:133460338-133460360 TAGTCAAGGCAGATAGTTAAAGG + Intronic
1016181317 6:141151345-141151367 TATTTTAGGCAGATAGAAAAAGG - Intergenic
1016499475 6:144703205-144703227 TGGACAAAGCAAATAGAAAATGG + Intronic
1016771404 6:147856280-147856302 TAGTGAATGCAGATGGGAATGGG + Intergenic
1019135209 6:169903592-169903614 GAATCAATGAAGAGAGAAAATGG + Intergenic
1026138851 7:67687229-67687251 AAGTAAGTGTAGATAGAAAAGGG - Intergenic
1026249538 7:68657319-68657341 TATTCATAGCAGATAAAAAATGG + Intergenic
1026416768 7:70189821-70189843 TAGTCAATGTAGCTGGAAATGGG - Intronic
1026527124 7:71163791-71163813 GAGTTGATGCAGATCGAAAAGGG + Intronic
1026534138 7:71226423-71226445 TAGACCACGAAGATAGAAAAAGG - Intronic
1026667738 7:72358380-72358402 TAGTAAATGGAGAAAGGAAAAGG + Intronic
1027534734 7:79383415-79383437 TAGTTAATACAGGTATAAAATGG + Intronic
1028323182 7:89487920-89487942 TAATCAATGCACATTTAAAAAGG + Intergenic
1028576593 7:92358775-92358797 TAGTTACTGCAGATATATAAGGG + Intronic
1029638785 7:101804929-101804951 CAGTCTAAGCAGCTAGAAAAGGG - Intergenic
1030952395 7:115807545-115807567 TAGTCAAAACAGGAAGAAAAGGG - Intergenic
1031204017 7:118730378-118730400 TAGTCTATGCATAAAGAAATTGG + Intergenic
1031208313 7:118791296-118791318 AAGTCCATGCAGATAGACATTGG + Intergenic
1031997753 7:128243752-128243774 TAGCCAATGCAGATCGAGAATGG + Intronic
1032287917 7:130557008-130557030 TAGCCAATGCAATTAGATAAGGG + Intronic
1033532378 7:142277904-142277926 TAGCCAATGGAGATTGAAACTGG + Intergenic
1033871912 7:145763698-145763720 TGGGCAATGCAGAAAGAAAGAGG - Intergenic
1033906701 7:146213944-146213966 GAGTCAATGCAAATTTAAAAAGG - Intronic
1036736975 8:11328567-11328589 TATTAAATGTAGAAAGAAAATGG + Intergenic
1037250665 8:16890236-16890258 TAGTCCATGTAAATAGAACAGGG - Intergenic
1041442419 8:57911639-57911661 TAGTGCATGCTGATAGAAACTGG - Intergenic
1041618860 8:59940734-59940756 AAATCAATGCAAATAGCAAAAGG - Intergenic
1042041665 8:64598275-64598297 TAATCAATGCTGAAAGAACAAGG + Intronic
1042054139 8:64745231-64745253 TCGTCTATGCAGAGAGCAAATGG - Intronic
1042485663 8:69342829-69342851 AAGTAAATGAAAATAGAAAAAGG - Intergenic
1043126940 8:76409782-76409804 GAGTCCTTGCAGAGAGAAAAGGG - Intergenic
1043750146 8:83924928-83924950 TGGTCAATGAAGAAATAAAAAGG - Intergenic
1047125998 8:121961365-121961387 AAGTGTGTGCAGATAGAAAAGGG - Intergenic
1047132199 8:122034076-122034098 TGTTCATTCCAGATAGAAAAGGG - Intergenic
1048355638 8:133651989-133652011 TAGGCAATGCAGATACAGAAAGG + Intergenic
1048636512 8:136301545-136301567 TAGTGTATCCAGACAGAAAAGGG + Intergenic
1049327120 8:142027977-142027999 TGGACATTGCAGATAGAATACGG - Intergenic
1050100963 9:2119341-2119363 TTCTCAAGGCAGAAAGAAAAGGG - Intronic
1050907406 9:11022603-11022625 TTGTTGATGCAGATAGAAAGTGG + Intergenic
1051642428 9:19236165-19236187 TATTCCTAGCAGATAGAAAAGGG - Intronic
1052113819 9:24624154-24624176 TAGTCAATGTAGACAGAAAAAGG - Intergenic
1052202586 9:25800863-25800885 TAGTCAATGAAAATTAAAAAGGG + Intergenic
1052679469 9:31670717-31670739 TGTTCACTGTAGATAGAAAATGG - Intergenic
1052698604 9:31910597-31910619 GAGTCAAAGCAAATAGAACAAGG - Intergenic
1055018927 9:71648460-71648482 TTTGCAATGCAGATGGAAAAAGG + Intergenic
1056429309 9:86511558-86511580 TATTCAGTGCAGGTAGAAAAAGG + Intergenic
1057320043 9:94004339-94004361 TAATCAACCCAGATAGCAAAAGG + Intergenic
1057779786 9:98040235-98040257 TTGTCAAAGCAGGTGGAAAATGG - Intergenic
1058571968 9:106356734-106356756 TAGTCAAAGAAGACAAAAAAGGG - Intergenic
1059974815 9:119704600-119704622 TACTCAGTAGAGATAGAAAAGGG + Intergenic
1203570772 Un_KI270744v1:128451-128473 CAGTCATGGCAGAAAGAAAAGGG + Intergenic
1185778619 X:2826393-2826415 TAGACACTGGAGATACAAAAGGG + Intergenic
1187816075 X:23233138-23233160 TAGTCAAATCAAACAGAAAAGGG - Intergenic
1188289387 X:28368922-28368944 TAGTCACTGGAGATTCAAAAGGG - Intergenic
1188533288 X:31166005-31166027 TAATCAAGGCAGTTTGAAAAAGG + Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189441208 X:41037817-41037839 TAGTCAATGGAAATAGACACAGG + Intergenic
1189929068 X:45988733-45988755 TAGTCACCCAAGATAGAAAATGG + Intergenic
1191669447 X:63735448-63735470 TGGGCAAGGCAGAGAGAAAAAGG + Intronic
1192630599 X:72774969-72774991 TAGTCAATGTAATAAGAAAAGGG + Intergenic
1192651111 X:72945835-72945857 TAGTCAATGTAATAAGAAAAGGG - Intergenic
1193841134 X:86409745-86409767 TAGCCAATGCAGATATACAAAGG + Intronic
1194329695 X:92566410-92566432 TAATTAATGCAGAAAGGAAAGGG + Intronic
1196575344 X:117311245-117311267 TACTCATTGAAGAGAGAAAAGGG + Intergenic
1196929613 X:120668499-120668521 TAGTCAATGCAGGGATATAAAGG + Intergenic
1197294255 X:124698302-124698324 TAGTCAAGATAGATAGCAAATGG - Intronic
1197539613 X:127741253-127741275 TAGTCAATACAGTTAGACAAGGG + Intergenic
1197708293 X:129649274-129649296 CAGTCAAGGAAAATAGAAAAGGG - Intronic
1197812165 X:130454952-130454974 AAGACAATTCAGCTAGAAAAAGG - Intergenic
1198586377 X:138127003-138127025 GATTCAAAGCAGATAGAAAAGGG + Intergenic
1198993473 X:142544797-142544819 TACCCAAAGCAGATAAAAAATGG - Intergenic
1199519227 X:148716559-148716581 TAGTAAACTCAGAGAGAAAATGG - Intronic
1200274518 X:154718994-154719016 TAGACAATGAAGCTAGAAAAGGG + Intronic
1200638397 Y:5685602-5685624 TAATTAATGCAGAAAGGAAAGGG + Intronic
1202353190 Y:24016530-24016552 CAGTTAATGCAGAAACAAAATGG - Intergenic
1202517589 Y:25653585-25653607 CAGTTAATGCAGAAACAAAATGG + Intergenic