ID: 923582941

View in Genome Browser
Species Human (GRCh38)
Location 1:235235873-235235895
Sequence CAGGGTAAATACTCAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923582941 Original CRISPR CAGGGTAAATACTCAGTGCA TGG Intronic
900811396 1:4804025-4804047 CAGGGTAAATGCTCAGTAGATGG - Intergenic
903008396 1:20313465-20313487 CACAGTAAATACTCAAAGCATGG + Intronic
905726011 1:40252626-40252648 CAGGGTACATACTCATTGAGTGG - Intergenic
907851400 1:58258490-58258512 CAGGGTAACTGCCCAGTCCAAGG - Intronic
911089764 1:94009224-94009246 CAGAGTAAAGACTCAGGGCCTGG + Intronic
912709623 1:111941135-111941157 CAGGGTTAAAAATCAGAGCAGGG + Intronic
913484159 1:119318379-119318401 CTGGGTAAATATTCACTGCAAGG + Intergenic
914243629 1:145870052-145870074 CATGGTAAGTACTCAGTAAAAGG - Intronic
914322734 1:146580907-146580929 CAGGTTACAGACTCAGGGCAAGG + Intergenic
917045598 1:170856509-170856531 CAAGGTATTTACTCATTGCAAGG + Intergenic
917571681 1:176272381-176272403 GAGTGCAATTACTCAGTGCATGG + Intergenic
917616473 1:176750879-176750901 AAAGGTAAATTCTCAGTTCAAGG - Intronic
919306260 1:195842824-195842846 CTGGGTAAATACCCAGTACTGGG + Intergenic
922660082 1:227422277-227422299 CAGGGTGAATAGACAGTGAAAGG - Intergenic
923582941 1:235235873-235235895 CAGGGTAAATACTCAGTGCATGG + Intronic
923669329 1:236026648-236026670 CAGAGTAAATGCTCAGTAAATGG - Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
924786745 1:247206343-247206365 CATGTTAAGTACTCAGTGCAGGG + Intergenic
1064297570 10:14092241-14092263 CCGGGTAAATACTCAGCACTCGG + Intronic
1064508082 10:16055593-16055615 CAGAGAAAGTACTCAGTACAAGG + Intergenic
1065564546 10:26995668-26995690 CAGGGTTAATGCTCAGTCCTTGG + Intronic
1065806427 10:29397462-29397484 CAGGTTAAATACTAAGTGCTGGG - Intergenic
1065942742 10:30579676-30579698 CAGGTTAAATACTAAGTGCTGGG + Intergenic
1066357049 10:34695052-34695074 CTGGTTAAATACCCTGTGCAGGG + Intronic
1069096753 10:64268644-64268666 TATGGTAAGTGCTCAGTGCATGG + Intergenic
1070431820 10:76348073-76348095 CAGTGAAGATGCTCAGTGCAGGG + Intronic
1072359986 10:94650056-94650078 TTGGGTAAATACTCAGTACTGGG + Intergenic
1074103498 10:110372349-110372371 CATGGTACATGCTCAGTGAAAGG + Intergenic
1074497018 10:113988097-113988119 CTGGGTCACTACTCAGTTCAGGG + Intergenic
1075283365 10:121160743-121160765 CAGGCTAAAGACTGAGTCCATGG - Intergenic
1075652797 10:124140249-124140271 CAGGGTAAATAGTCAATCAATGG - Intergenic
1075662309 10:124206530-124206552 CACAGCAAATGCTCAGTGCATGG - Intergenic
1075927995 10:126268915-126268937 CAGGGTAAGTCCACAGTTCAAGG + Intronic
1075976353 10:126699467-126699489 CAGGGTAGATACCCAGTGATGGG - Intergenic
1076348270 10:129795556-129795578 CAGTGTAAATATTTAGTACAGGG - Intergenic
1076548053 10:131259408-131259430 CAGAGTAAATCCTCAGTTCCTGG + Intronic
1077810705 11:5633551-5633573 CAGGGTAAATACTTACTCTAAGG + Intronic
1079156836 11:17955791-17955813 CAGGGCAAAGAATCAGAGCAAGG + Intronic
1080743917 11:35090781-35090803 CATGGTAAGTACTCAATGAATGG + Intergenic
1080781285 11:35432206-35432228 CAGGGACAAAACTCAGTGAAGGG - Exonic
1080910453 11:36592791-36592813 CTGGGTCCATGCTCAGTGCATGG - Exonic
1084769763 11:71335017-71335039 CAGGGTAAGTGCTCAGGACATGG + Intergenic
1084858163 11:72001853-72001875 CAGGGTTAAGACTCAGCACAGGG + Exonic
1085152668 11:74264605-74264627 CAAGGTGCATACTCAGTGCCAGG - Intronic
1086726424 11:90190258-90190280 GAGGTTAAATAACCAGTGCAAGG + Intronic
1088438903 11:109846615-109846637 CATGGTAAATTCTCAGAGAAAGG + Intergenic
1089027024 11:115281683-115281705 CAGGGCAAATATGCAGTACAAGG + Intronic
1089419027 11:118316995-118317017 CAGGGTGAATTATTAGTGCAGGG - Intergenic
1090875094 11:130781788-130781810 AAGGATAAATACCCACTGCAAGG + Intergenic
1091929156 12:4380711-4380733 CATGGCATATACTCAGTACAGGG - Intergenic
1096451988 12:51750878-51750900 CAGGGTAAATCCTCAATAAATGG - Intronic
1097876794 12:64650869-64650891 AAAAGTAAATACTCGGTGCAAGG - Intronic
1100506128 12:95222031-95222053 TAGGGCAAATACCCAGTCCATGG - Intronic
1103356081 12:120321611-120321633 CAGAGTAAATAATCAGTAGATGG + Intergenic
1104487236 12:129162245-129162267 CAGGGTCTTTCCTCAGTGCATGG - Intronic
1106630604 13:31467933-31467955 CAGGGTAATTACCTAGTTCAGGG + Intergenic
1107732971 13:43366892-43366914 CATGGTAAATACTCAATAAATGG + Intronic
1107960875 13:45556940-45556962 CTGGGTAAATACTCAGTAGTGGG + Intronic
1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG + Intergenic
1112128896 13:96499560-96499582 CAGGTGGAATACTCAGGGCAAGG + Intronic
1114202877 14:20539269-20539291 CTGGGTAAATACTCAGTAATGGG + Intergenic
1117098968 14:52325898-52325920 CAGAGTAAGTACTCAGAGAAGGG + Intronic
1117804205 14:59473688-59473710 CAGGGTAGGTAGTCAGGGCAGGG + Intronic
1118287478 14:64489472-64489494 TAGGGCAAATACTTAGTGCTTGG + Intronic
1119779683 14:77269821-77269843 CACGGAAAGTACTCAGCGCAGGG - Intronic
1121031093 14:90659351-90659373 CACGGGAAATACTGAGTTCAAGG + Intronic
1123670108 15:22647912-22647934 CAGGATAAATAGCTAGTGCATGG + Intergenic
1124526082 15:30454328-30454350 CAGGATAAATAGCTAGTGCATGG + Intergenic
1124772572 15:32553357-32553379 CAGGATAAATAGCTAGTGCATGG - Intergenic
1126398359 15:48243325-48243347 CATTTTAAATAATCAGTGCAGGG - Intronic
1127198076 15:56612113-56612135 CAGGGCGAATCCACAGTGCAAGG - Intergenic
1132358507 15:101192189-101192211 GAGGGCAATTACTCAGTGCTTGG - Intronic
1134078986 16:11312047-11312069 CAGGGTAAGCACTGAGTCCAAGG - Intronic
1138907279 16:61352435-61352457 CTGGGTAGATACCCAGTGCTGGG - Intergenic
1139436420 16:66939186-66939208 CAGGGCAAATAATCAGTCCAGGG - Intronic
1140010830 16:71129943-71129965 CAGGTTACAGACTCAGGGCAAGG - Intronic
1142590667 17:1004318-1004340 AACAGTAAATACTCTGTGCACGG - Exonic
1150969142 17:70007294-70007316 TAGGGTATATATTCAGGGCATGG + Intergenic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1153845601 18:9046969-9046991 CAGAGTAAGTCCTCAGTGAATGG + Intergenic
1159112398 18:64074476-64074498 ATGGGTGAATATTCAGTGCAAGG + Intergenic
1159708711 18:71726378-71726400 CTGGGTAGATACTCAGTAGAGGG - Intergenic
1160830428 19:1102165-1102187 CTGAAGAAATACTCAGTGCAGGG + Intergenic
1161642236 19:5431557-5431579 CAGGTTAAATCCTCAGCACAAGG + Intergenic
1163776136 19:19219008-19219030 CAGGGTAAAGAGACAGGGCAGGG - Exonic
1165978755 19:39701702-39701724 CTGGGTATATACTCAGTGATGGG - Intergenic
1166439427 19:42798498-42798520 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166457465 19:42954049-42954071 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166474410 19:43109268-43109290 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166495054 19:43294821-43294843 CTTGGTAAAAACACAGTGCAGGG + Intergenic
1168564242 19:57409949-57409971 CAGGTACAATACTAAGTGCATGG - Intronic
926369390 2:12164708-12164730 CATGTTAAATACTCAGTGGATGG - Intergenic
929241702 2:39660140-39660162 CAGAGTAAACAGCCAGTGCAAGG - Intergenic
930287473 2:49448885-49448907 CAGGTGAAGTACTCAGTGGAGGG + Intergenic
930506884 2:52293836-52293858 CAGAGAACAGACTCAGTGCAGGG - Intergenic
931633812 2:64324250-64324272 CATGGTAACTACTTAGTTCAAGG - Intergenic
934700358 2:96434730-96434752 CAGGGTCAGTGCTCAGTGAATGG - Intergenic
937037630 2:118794945-118794967 CAGAGTAAATGTTCAGTCCATGG - Intergenic
941390277 2:164905070-164905092 CAGAGTAAGTACTCAATACATGG + Intronic
941645457 2:168035610-168035632 CAGGGCAAATACTTAGCACAAGG + Intronic
941785913 2:169498409-169498431 CAGAGTAAATACTCAATAAATGG - Intronic
942393267 2:175518862-175518884 CTGGGTAGATACTCAGTAGAGGG - Intergenic
944581415 2:201136134-201136156 TAGGGGAAGTACTCTGTGCATGG + Intronic
945224372 2:207518242-207518264 AAGGGTAAATATTCAGTGAGAGG - Intergenic
946743658 2:222825250-222825272 CAGGGTAGAAACTCAGTGGCTGG + Intergenic
947216902 2:227758132-227758154 CAGGGGACGTACTCTGTGCATGG + Intergenic
948219608 2:236259333-236259355 CAGGGTTAATACCCTGTGCTAGG + Intronic
1171183087 20:23105324-23105346 CAGGGTCTATACACACTGCAGGG - Intergenic
1171363911 20:24610766-24610788 CTGGGCAAATACACAGTGCCTGG - Intronic
1171410437 20:24943500-24943522 CAGTGTAAATGCTCAGGGCTTGG - Intergenic
1171970854 20:31564168-31564190 CCTGGTAAATACTCAGTGAATGG - Intronic
1173307805 20:41867019-41867041 CTGGGTAAATACCCAGTTAAGGG + Intergenic
1175337678 20:58206772-58206794 AAGGTTAGAAACTCAGTGCAAGG + Intergenic
1175638137 20:60602653-60602675 CAGGGTAAATGCCCAGTGCACGG - Intergenic
1175720312 20:61281672-61281694 CAGGATAAATCCTCAGTGTTGGG + Intronic
951477023 3:23117939-23117961 CAGGGTAAAAGTTCAGTGGATGG + Intergenic
952714428 3:36464967-36464989 CAGGGTAAATAGCCAGTACTGGG + Intronic
953974736 3:47373801-47373823 TAGGGTAATTACACAGTCCATGG - Intergenic
959919748 3:111857631-111857653 CAGGGCAAAAACTCAGGACAGGG + Intronic
959934270 3:112013224-112013246 CAGGGTAGGTCCACAGTGCAGGG + Intronic
961981964 3:131089114-131089136 CAGGCTAAATATTAAGTACATGG + Intronic
962450582 3:135513215-135513237 TAAGGTAAATACTGAGTGCTAGG - Intergenic
963070785 3:141303670-141303692 CTGGGAAACTACTCAGTGCCAGG - Intergenic
965398776 3:168193471-168193493 CAGAGTAAATACTCAATAAATGG - Intergenic
966543967 3:181123526-181123548 TTGGGTAAATACTCAGTAAAGGG - Intergenic
966580831 3:181560714-181560736 CAGGGAAAATATCCAATGCAAGG + Intergenic
970253609 4:14143349-14143371 CATGGTAAAAAGTCAGTGAATGG - Intergenic
972847593 4:43008226-43008248 CAAGATAAATAGTCATTGCATGG + Intronic
974260953 4:59522832-59522854 CTGGGAAAATCCACAGTGCAAGG + Intergenic
975491613 4:74995452-74995474 CATAGTAAATACTCAGTAAAGGG - Intronic
976022024 4:80640500-80640522 CAGGGAGAATACTCTGGGCATGG - Intronic
976673827 4:87682864-87682886 CATGGTAAATACTCAGGGACAGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977474375 4:97486655-97486677 CAGGGTAGATACTCAGTCATGGG - Intronic
977835836 4:101645612-101645634 CAGAGAAAATGCTCAGTGGAAGG + Intronic
979711553 4:123785924-123785946 AAGGGTCAATATTCAGAGCATGG - Intergenic
979980251 4:127246445-127246467 CATGGTAAATACTCATTGTCAGG - Intergenic
982124919 4:152176113-152176135 AAGGGTAAATGCACACTGCAGGG + Intergenic
983456025 4:167966157-167966179 CAGGATAAATACCCAGTGGAGGG + Intergenic
984305070 4:177978940-177978962 CATGGTAAATGCTCAATGAATGG + Intronic
987725451 5:21693131-21693153 AAGTGTAATTATTCAGTGCATGG + Intergenic
988546096 5:32158891-32158913 CAGCATAGATACTCAGTGTATGG - Intronic
989970081 5:50512928-50512950 GAGGTTAAATAATTAGTGCAAGG - Intergenic
991182603 5:63771052-63771074 CAGGGTAAATAACCATTGCTGGG - Intergenic
992199163 5:74367333-74367355 CAGGGTGAACACACAGTGCTAGG - Intergenic
993734948 5:91465248-91465270 CTGGGTATATACTCAGTAAAGGG - Intergenic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997962977 5:138336786-138336808 AAGGGGAAATAAGCAGTGCAAGG + Intronic
999122946 5:149223906-149223928 CATGGTAAAGACTCAGCACAGGG + Intronic
1001732086 5:173968223-173968245 CAGGGTCACTGCCCAGTGCAGGG + Intergenic
1004595629 6:17096778-17096800 CAGGGTAATAACTCAGAGAACGG - Intergenic
1005155707 6:22803843-22803865 CAAAGTAAATACTCTGTGCTAGG + Intergenic
1008662554 6:53683050-53683072 CATGGTAGATACTCAGTCAATGG - Intergenic
1008686109 6:53927937-53927959 CATAGTAAGTACTCAGTGAATGG - Intergenic
1010693285 6:78936557-78936579 CAGACCAAATACTTAGTGCATGG - Exonic
1014908946 6:127065696-127065718 CTGGGTAATTCCTCAGTGCTGGG - Intergenic
1015199226 6:130560468-130560490 CAGGGCATGTACTGAGTGCATGG - Intergenic
1015478773 6:133683430-133683452 CTGAGTGAATAATCAGTGCAGGG + Intergenic
1017023975 6:150165638-150165660 CAAGTTAAACACTCAGTGCAAGG + Intronic
1017335480 6:153253820-153253842 CTGGGTAAAAACTGAGTACAAGG + Intergenic
1020658217 7:10952438-10952460 CAGGGGAAATATTCAGTGAATGG + Intergenic
1023478682 7:40609250-40609272 CAGGGTAGCTTCTCACTGCATGG + Intronic
1024581627 7:50805414-50805436 CTAGGTAAGTACTCTGTGCATGG + Intergenic
1024843315 7:53613365-53613387 AAGGGAAAATATTCAGTGAAAGG - Intergenic
1026571129 7:71532012-71532034 AATGGCAAATGCTCAGTGCATGG + Intronic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1030765472 7:113404140-113404162 CAGGTTAAATAAACAGAGCAAGG + Intergenic
1033956351 7:146853564-146853586 CCAGGTAAGTACTCAGTGCATGG - Intronic
1034261363 7:149758369-149758391 CACGGCAGGTACTCAGTGCATGG + Intergenic
1034877445 7:154738149-154738171 CATGGTAAATTCTCTGTGCTGGG - Intronic
1038428725 8:27482801-27482823 TAGGGAAACTTCTCAGTGCATGG - Intergenic
1042640320 8:70927193-70927215 CAGTGTAAATGCTCAGTCTAGGG + Intergenic
1046515854 8:115259620-115259642 AAGGGTAAAAACTAAGTGGATGG - Intergenic
1046530421 8:115438252-115438274 CAGGGCAGATACTCAATGAATGG - Intronic
1046569671 8:115947740-115947762 CATGGTAAATACTCATTACATGG - Intergenic
1047079009 8:121438485-121438507 TAAGGGAATTACTCAGTGCAAGG + Intergenic
1050311166 9:4354554-4354576 CAGGTCAAAACCTCAGTGCACGG + Intergenic
1052463105 9:28792974-28792996 CAAGAAAAATAGTCAGTGCATGG + Intergenic
1053186512 9:36021028-36021050 CATGCTAAAAAATCAGTGCAAGG - Intergenic
1055409930 9:76018258-76018280 CAGTGTAAATACTCACATCATGG - Intronic
1055677035 9:78674369-78674391 CCAGGTAAATACTCATTTCATGG - Intergenic
1057560344 9:96123230-96123252 CAGGGGAAATCCTTAGTACAGGG - Intergenic
1058846381 9:108963766-108963788 CAGGATAAAGACACAGTGCAGGG + Intronic
1058863440 9:109139930-109139952 CAGAATGAATTCTCAGTGCAAGG + Intronic
1059749268 9:117232512-117232534 CAGGGTAAGTGCTGAGTGCCTGG - Intronic
1185906397 X:3937744-3937766 CAGGGTTAGTCCTCAGGGCATGG + Intergenic
1188039871 X:25359181-25359203 GAGGATTAATACTCAGTCCATGG - Intergenic
1190639029 X:52465179-52465201 CAGGGTAGATGCTCTGTGAAGGG + Intergenic
1192437611 X:71152646-71152668 CATGGTGAATATTCAGTACATGG + Intronic
1193989667 X:88290795-88290817 CTGGGTAAATACTCAGTAGTGGG - Intergenic
1196725745 X:118893607-118893629 CACAGTAAGTACTCACTGCAAGG - Intergenic
1201272943 Y:12272996-12273018 CAGAGTGAATACTCATTCCATGG - Intergenic