ID: 923584356

View in Genome Browser
Species Human (GRCh38)
Location 1:235253028-235253050
Sequence GAAAACATCTTGTATAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923584355_923584356 14 Left 923584355 1:235252991-235253013 CCAATTTCTAGTGAAAAAGAAAC 0: 1
1: 0
2: 6
3: 80
4: 1200
Right 923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG 0: 1
1: 0
2: 1
3: 28
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923584356 Original CRISPR GAAAACATCTTGTATAAAAC AGG Intronic
900698117 1:4025406-4025428 GAAAAGATCATGTCTAAAATAGG + Intergenic
905241338 1:36583432-36583454 GAAATCATCTGGTATACAGCAGG - Intergenic
905876524 1:41435294-41435316 GAAAATTTCTTGAATAAGACAGG + Intergenic
906344201 1:45005071-45005093 GAGAACATCTTGGAGAAAGCTGG + Intronic
906465745 1:46077324-46077346 TTAAACATTTTGTATAAAAATGG - Intronic
906741323 1:48188312-48188334 GAAAATATTTTGTCTAAAAAAGG - Intergenic
908297730 1:62729959-62729981 CAAAACATATTGTATAAAAGAGG - Intergenic
908535879 1:65076657-65076679 TACAACAACTTGAATAAAACAGG - Intergenic
908604076 1:65774885-65774907 GAAAAATTCTAGAATAAAACAGG - Intergenic
909136817 1:71811677-71811699 GAAAACTTCTTCTCTAAAACAGG - Intronic
910181718 1:84491798-84491820 TAAAACACCCTGGATAAAACAGG - Intronic
910916037 1:92290330-92290352 AAATACAACTTGTATTAAACAGG - Intronic
911655700 1:100440822-100440844 GAAACAACCATGTATAAAACAGG - Intronic
915436861 1:155913400-155913422 GAAAACTTCTTGACTAAAACTGG - Exonic
915758686 1:158288899-158288921 CAAAACACATTGTATAAAAAGGG - Intergenic
916697366 1:167252785-167252807 GATAACTTCTTGTTTATAACAGG + Intronic
918350805 1:183653786-183653808 GAACAAATCTTGTCTTAAACTGG - Intronic
918362055 1:183769835-183769857 TAAAACATCATGTATTAACCAGG + Intronic
919222470 1:194647368-194647390 TCATACATTTTGTATAAAACAGG + Intergenic
919370252 1:196715153-196715175 GAAAATGTCTTGTATAACATAGG + Intronic
919383300 1:196886076-196886098 GAAAATGTCTTGTATAACAAAGG + Intronic
922248264 1:223821630-223821652 GCAAACAACATGAATAAAACTGG - Intronic
923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG + Intronic
924401004 1:243681888-243681910 TAAAACACCTTGTAAAAAGCAGG + Intronic
1063790891 10:9445869-9445891 GAAAACACTTTGTTTAAAAATGG - Intergenic
1064513148 10:16117055-16117077 AAAAATATCTTGGAAAAAACTGG + Intergenic
1064844894 10:19640588-19640610 TAAAATATCTTATATAGAACAGG - Intronic
1066706146 10:38180656-38180678 GAAAACAGCTGTTAGAAAACAGG - Intergenic
1066784218 10:38985070-38985092 GAAAACAGCTGTTAGAAAACAGG - Intergenic
1066983825 10:42445406-42445428 GAAAACAGCTGTTAGAAAACAGG + Intergenic
1067254791 10:44626434-44626456 GTAAACATTTTGTATAAGACTGG - Intergenic
1067371302 10:45685520-45685542 GAAAACAGCTGTTAGAAAACAGG - Intergenic
1067388481 10:45840631-45840653 GAAAACAGCTGTTAGAAAACAGG + Intronic
1067417585 10:46116328-46116350 GAAAACAGCTGTTAGAAAACAGG - Intergenic
1067502999 10:46823216-46823238 GAAAACAGCTGTTAGAAAACAGG - Intergenic
1067905361 10:50285173-50285195 GAACACATTTTGTAGAAAATTGG + Intergenic
1068012617 10:51472891-51472913 GTAAAAATCATGTATTAAACTGG - Intronic
1068622051 10:59197096-59197118 GAGAACATCTTTTGGAAAACAGG - Intronic
1069516750 10:69083663-69083685 GAAAACATCTGATTTAAAAAAGG - Intergenic
1069641532 10:69958864-69958886 CAAAACATCTTGTAAACAAAAGG - Exonic
1070261973 10:74865486-74865508 TAATACAGATTGTATAAAACTGG - Intronic
1070584785 10:77755669-77755691 TAAAACTTCTAGAATAAAACAGG + Intergenic
1070599436 10:77855579-77855601 TAAAACTTCATTTATAAAACAGG + Intronic
1071688586 10:87790799-87790821 GACAACATCCTGTATAAAATAGG - Intronic
1074038041 10:109760955-109760977 GAAAACATCTAATAAAAAATGGG - Intergenic
1074493858 10:113961617-113961639 GGAGTCCTCTTGTATAAAACTGG + Intergenic
1076225801 10:128774219-128774241 GCAAACAGCATCTATAAAACAGG - Intergenic
1076321460 10:129585181-129585203 GATATCTTCTTGTGTAAAACGGG + Intronic
1077275485 11:1704997-1705019 TAAAACATTTGGAATAAAACAGG + Intergenic
1077682272 11:4253141-4253163 TAAAACAGCTAGTAGAAAACGGG - Intergenic
1078162174 11:8850355-8850377 GAAAACAACTTATTTAAAAATGG + Intronic
1078863998 11:15279888-15279910 GAAAACACCATTTATAAAATGGG + Intergenic
1082193611 11:49275339-49275361 GAAAAAATCATGTACAAAAAAGG + Intergenic
1083004892 11:59334468-59334490 AAATACATATTTTATAAAACTGG + Intergenic
1084724468 11:70932126-70932148 GAAAACATTTTGTAGACATCTGG + Intronic
1085610971 11:77948697-77948719 GAAAAAATCTTGAATATAAATGG + Intronic
1086546780 11:88005698-88005720 CAAAACTACTTGTAAAAAACAGG - Intergenic
1087230195 11:95652563-95652585 AAAGACTTCTTGTATAAAAAGGG - Intergenic
1087435676 11:98114000-98114022 GAAAACTTCCAGCATAAAACTGG - Intergenic
1087712806 11:101573171-101573193 GAAATCATTTTGTATAAGGCAGG + Intronic
1088354852 11:108932181-108932203 TAAAACTTGATGTATAAAACAGG + Intronic
1089899300 11:121964115-121964137 GAAAACATCTTCTAGAAACTAGG + Intergenic
1090157494 11:124456860-124456882 GAAGACATCTTCTATAAAACTGG - Intergenic
1091205050 11:133815007-133815029 GAAAACAGCTTGTATTAGTCAGG + Intergenic
1091273413 11:134333282-134333304 GAAAACATCTTGGGAACAACCGG - Intronic
1092475643 12:8817073-8817095 CCAAACATCTTGTGTAGAACAGG + Intergenic
1093119287 12:15248523-15248545 GAAAAGATATTTTATAAAACTGG + Intronic
1093679315 12:21982610-21982632 GAAAACATCTTGAAAGCAACCGG + Intergenic
1094685455 12:32709210-32709232 GTAACCATGTTGTATAGAACGGG + Intronic
1095904905 12:47367884-47367906 GATAAAATCTTGTAAAAATCAGG + Intergenic
1096719314 12:53509249-53509271 TAAAACAGCTTGCATAGAACAGG + Intronic
1097006312 12:55920807-55920829 GTAAACATCTTTTAAAATACTGG - Intronic
1097446995 12:59683700-59683722 GAACACACCTTGAATAAAAGTGG + Intronic
1098242569 12:68483374-68483396 GAAAAAATCATGTTTAAAAATGG - Intergenic
1099453212 12:82832986-82833008 GACACCATCTTGGATAGAACTGG - Intronic
1099553971 12:84086014-84086036 GATCACCTCTTGTATCAAACAGG + Intergenic
1099599506 12:84715033-84715055 TAAAACTTGTTTTATAAAACAGG + Intergenic
1099955366 12:89348231-89348253 TAAAAAAATTTGTATAAAACTGG - Exonic
1101254088 12:102960457-102960479 GAAACTAGTTTGTATAAAACAGG - Exonic
1101363684 12:104051367-104051389 GATAACATCTTGTATATATTGGG - Intronic
1106047219 13:26154221-26154243 TAAAACAACTAGTAGAAAACAGG + Intronic
1107082647 13:36391276-36391298 GAAGACATTTTGTATAACCCTGG + Intergenic
1107623204 13:42255009-42255031 GAAAATATCTTGTATATATTGGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108812182 13:54240909-54240931 GAAAAAATTTTTTAAAAAACGGG + Intergenic
1109253329 13:60047666-60047688 TAAAACATCTAGAAGAAAACAGG + Intronic
1109440176 13:62359817-62359839 GAAAACAAATTGTATACAGCAGG + Intergenic
1110300278 13:73918483-73918505 AAAAATATCTTGTATAGTACTGG - Intronic
1110958520 13:81589360-81589382 GTAAACATATTGGATAAAATAGG - Intergenic
1111050313 13:82874561-82874583 AAAAACATGTTTTATAAATCTGG + Intergenic
1111320130 13:86616354-86616376 GATAACAAATTGTATGAAACAGG + Intergenic
1111378783 13:87417856-87417878 CAAAGGATGTTGTATAAAACAGG + Intergenic
1113124638 13:106963202-106963224 AAAAGCATCTCATATAAAACTGG - Intergenic
1113294629 13:108945042-108945064 GAATCCATCTTTTGTAAAACAGG + Intronic
1113901925 13:113802374-113802396 GAGAACATCTGGTTTGAAACAGG - Intronic
1115925075 14:38423979-38424001 GAAAAAATCTTTTAAAAAATGGG - Intergenic
1116082275 14:40189844-40189866 GTAAATATCTTGTATTAAATAGG - Intergenic
1116153796 14:41177189-41177211 TAAAACATTTTTTATAAAGCAGG + Intergenic
1116486729 14:45458747-45458769 GAAAACTTGTTGTAGAAAAGGGG - Intergenic
1116556984 14:46323370-46323392 TAAAACTTTTTGTACAAAACAGG + Intergenic
1116574933 14:46561438-46561460 GAAAACTTCTAGAAGAAAACGGG + Intergenic
1116849720 14:49895472-49895494 GAAAAGATGTTTTATAAAAGAGG + Exonic
1118133126 14:62990120-62990142 GAAAACATTTTGAAAAAAAAAGG + Intronic
1118791475 14:69097286-69097308 GAAAACAGCTTGTTTCATACAGG + Intronic
1120496369 14:85242079-85242101 GAAAAGATCTTCTTTGAAACTGG + Intergenic
1124005390 15:25791932-25791954 GGAAACAACATGTATAATACAGG - Intronic
1126524956 15:49643162-49643184 GAAAATATCTTGTTTCAAACTGG + Intronic
1127848996 15:62896846-62896868 TCTAACATATTGTATAAAACAGG + Intergenic
1128365637 15:67000018-67000040 GAAAATATCTTTCATAAAGCTGG - Intergenic
1130170468 15:81506888-81506910 GAAAACATTTTTTATATAAATGG + Intergenic
1130724619 15:86426096-86426118 GAACACATGTAGTAGAAAACAGG + Intronic
1133117355 16:3585071-3585093 GACCACACCTTGTATAACACGGG + Intronic
1134899182 16:17919687-17919709 GAAAACATCCTGACTAAAATGGG + Intergenic
1135568799 16:23532411-23532433 GAAAATATCTTGTATAGCCCTGG - Intronic
1136082356 16:27860463-27860485 GAGAACATCTTGTCTGCAACGGG - Intronic
1136635278 16:31517437-31517459 GATAACATCTTTTAGGAAACAGG - Intergenic
1139085951 16:63586021-63586043 AAAAACATTTTTTTTAAAACAGG - Intergenic
1139294088 16:65884896-65884918 AAAACCATATTGTAGAAAACTGG - Intergenic
1141666601 16:85468944-85468966 AAAATCATCTTGTATTAAAGTGG + Intergenic
1143588099 17:7861873-7861895 TCAAAGATCTTGTATAAATCAGG + Exonic
1145101909 17:20084727-20084749 GAAAACCTCTAGAAGAAAACAGG - Intronic
1146778777 17:35647833-35647855 AAAAACATTTTCTTTAAAACAGG - Intronic
1148294451 17:46488765-46488787 AAAATTATCTTCTATAAAACTGG + Intergenic
1148316634 17:46706478-46706500 AAAATTATCTTCTATAAAACTGG + Intronic
1151060440 17:71086104-71086126 GAAAATATCTTGTATATATCCGG + Intergenic
1152059305 17:78057790-78057812 GAAATCATATTTTATAAGACAGG - Intronic
1153082505 18:1244407-1244429 GAAAATAAAATGTATAAAACAGG + Intergenic
1153364104 18:4234586-4234608 GAAAATATTTTATATAATACAGG + Intronic
1153874616 18:9357991-9358013 GAAATCATTTTGTTTTAAACAGG + Intronic
1154077156 18:11214606-11214628 GAAAACATCACGTCTAAAAAAGG - Intergenic
1154160811 18:11980266-11980288 GTTAGCATCTTTTATAAAACGGG + Intergenic
1154271487 18:12924279-12924301 GAAAACATCTATCATAAGACAGG + Intronic
1155088031 18:22476582-22476604 GAAGAAACCTTGGATAAAACTGG + Intergenic
1155479811 18:26273124-26273146 TAGAACATGTTGTATAAGACAGG + Intronic
1155502568 18:26501706-26501728 GAAAACATTTTGTAGAACACAGG - Intronic
1155552980 18:26986027-26986049 AAAAACATCCAATATAAAACAGG + Intronic
1157058791 18:44262103-44262125 CAAGGCATCTTGTCTAAAACAGG + Intergenic
1158807339 18:60990087-60990109 GAAAACATTTTAAATTAAACAGG - Intergenic
1159049750 18:63409022-63409044 GAGGACATTTGGTATAAAACAGG - Intronic
1159167219 18:64719146-64719168 GAAAACCTTCTTTATAAAACAGG - Intergenic
1159613687 18:70554600-70554622 GAAAACATCTTTGAAAAGACTGG + Intergenic
1165610521 19:37147578-37147600 TAAAACATATACTATAAAACAGG + Exonic
925039559 2:720723-720745 GAAGCCATCTTGTTTAACACAGG - Intergenic
928205979 2:29283784-29283806 GTAAACATATAATATAAAACAGG - Intronic
929474900 2:42236463-42236485 TAAAACTTCATTTATAAAACAGG - Intronic
930545692 2:52764752-52764774 GAAATCATGTTATTTAAAACAGG + Intergenic
930722453 2:54650604-54650626 GATAACATCTTTAATAAAATTGG - Intronic
931013391 2:57945193-57945215 GAAAAAATCTTGTATTAAGTTGG + Intronic
932464087 2:71902396-71902418 GAAAACTTATTTTAAAAAACTGG - Intergenic
933034325 2:77373596-77373618 GAAAACATCTGATATAAACATGG + Intronic
933123973 2:78580001-78580023 GAAAACATCCTGTAATACACAGG + Intergenic
933408984 2:81900722-81900744 TGAAATATATTGTATAAAACTGG - Intergenic
934116186 2:88796922-88796944 GAAAATCTCTTGTGTAAAATGGG + Intergenic
934626971 2:95867919-95867941 GAAAATCTCTTGTGTAAAATGGG - Intronic
934806588 2:97233370-97233392 GAAAATCTCTTGTGTAAAATGGG + Intronic
934830921 2:97523805-97523827 GAAAATCTCTTGTGTAAAATGGG - Intronic
936002465 2:108847285-108847307 GAAAACTTCATTTACAAAACAGG - Intronic
937540282 2:122941946-122941968 GAAAGAATCTCATATAAAACTGG - Intergenic
938155415 2:128934737-128934759 GAAAACTACTAGTAGAAAACAGG - Intergenic
939285157 2:140120264-140120286 GCATACATCTTTTATAACACTGG - Intergenic
940529540 2:154863227-154863249 GAAAACATGTTCCATGAAACAGG - Intergenic
940534290 2:154919332-154919354 GAAAACATATTTCTTAAAACAGG + Intergenic
942395955 2:175549858-175549880 GAAAATATCTTCTATGAAACAGG - Intergenic
942771038 2:179520794-179520816 GAAAATAGCATGCATAAAACCGG - Intronic
943613918 2:190069284-190069306 GAAAACATCATGCAGAAAACTGG - Intronic
943719191 2:191185159-191185181 GAAAACATCCTGCATAATTCAGG - Intergenic
944126368 2:196297859-196297881 GAAGACAGACTGTATAAAACAGG - Intronic
944300340 2:198117069-198117091 GAAAAAAACTAGAATAAAACTGG + Intronic
944459788 2:199935799-199935821 AAAATCATCTTGTATAGGACCGG + Intronic
945376765 2:209086211-209086233 GACCACTTCTTATATAAAACAGG + Intergenic
947687313 2:232099641-232099663 TAGAACAGCTTGTGTAAAACAGG + Intronic
1169479115 20:5961621-5961643 GAAAATATCTGGTTTAAATCAGG - Intronic
1170035339 20:11983602-11983624 GAAAACATCTGATTTAAAAATGG + Intergenic
1177407522 21:20689765-20689787 GAAAACCTCCTGTAAAAAAAGGG + Intergenic
1177921662 21:27160149-27160171 AAAGAGGTCTTGTATAAAACTGG - Intergenic
1183027081 22:35073322-35073344 AAAATCATCTTCCATAAAACCGG - Intronic
949422776 3:3883902-3883924 GAAAATATCTTTTACTAAACTGG + Intronic
951234104 3:20214241-20214263 TAAAACATATTCTATAAAATAGG + Intergenic
951715724 3:25643705-25643727 TCAAAGATCTTGTATAAACCTGG + Exonic
952116951 3:30194118-30194140 GAAAATATCTTTTATGAAACAGG + Intergenic
952258657 3:31717462-31717484 GAAAGCATCTGGCAGAAAACAGG + Intronic
953400940 3:42616265-42616287 GAAAAGATCTTGTAGAATAAAGG + Intronic
955246125 3:57227052-57227074 GAAAATATCTTTTAAAAATCAGG - Intergenic
955359007 3:58256711-58256733 GAAAACATCAATGATAAAACTGG - Intronic
955443602 3:58983276-58983298 GCAAACAGCTTCCATAAAACAGG - Intronic
956994644 3:74810774-74810796 GCAGATATCTTGTATAAAACTGG + Intergenic
957597814 3:82289833-82289855 TTAAACATCTTTTATAAAGCTGG - Intergenic
962678543 3:137774959-137774981 GAAAACATTTTATAATAAACAGG + Intergenic
963131634 3:141863885-141863907 GAAAGTATCTTTTATAAAGCTGG - Intergenic
964310162 3:155383944-155383966 GAAAATGTCTTGTATTAAAAGGG - Intronic
965737055 3:171831862-171831884 GATCACAACTTGTATTAAACGGG + Intergenic
966011970 3:175089467-175089489 GATAACCTCATCTATAAAACGGG + Intronic
966510636 3:180758370-180758392 CACAACATGTTATATAAAACAGG + Intronic
967311084 3:188106862-188106884 AAAGACATCTAGTTTAAAACTGG - Intergenic
969649480 4:8455825-8455847 GAAAAAAATCTGTATAAAACTGG - Intronic
970397489 4:15683730-15683752 TAAAACATATTATTTAAAACAGG - Intronic
970751958 4:19374514-19374536 GGAAACATATTCTTTAAAACAGG - Intergenic
971057859 4:22933723-22933745 GAAAACATCATGAAAAAAAGAGG + Intergenic
971165952 4:24183906-24183928 GAAAACTTCATTTACAAAACGGG + Intergenic
971549755 4:27937316-27937338 GAAAACAGTTTGCTTAAAACTGG - Intergenic
971907795 4:32750113-32750135 GAAGACCTATTGCATAAAACAGG + Intergenic
972391079 4:38614177-38614199 AAAAAGGCCTTGTATAAAACAGG - Intergenic
972570373 4:40305142-40305164 GAAAACATCTTGTTTGTAAGGGG + Intergenic
972605998 4:40614465-40614487 GAACAGATCTTGTAGAAGACTGG + Intronic
973765858 4:54161935-54161957 TAAAACATCTTATAATAAACTGG - Intronic
974995437 4:69152372-69152394 TAAAACTGGTTGTATAAAACTGG - Intronic
975015276 4:69408571-69408593 TAAAATACATTGTATAAAACAGG + Intronic
976964297 4:91016951-91016973 GGAAAAATCTTGTAGAATACAGG + Intronic
977251042 4:94689135-94689157 GAAAACATGTTGTACATAATAGG + Intergenic
979294432 4:119014481-119014503 AAAACCGTATTGTATAAAACAGG - Intronic
979371428 4:119892530-119892552 GGAAACATCTTTTCAAAAACTGG - Intergenic
979403649 4:120282454-120282476 AAAATCATCTTCCATAAAACTGG - Intergenic
980602999 4:135050069-135050091 GAAGACATCTTCTAAAAAACTGG + Intergenic
980663536 4:135899054-135899076 GAAAACAGAGTGTATAAATCAGG + Intergenic
981260965 4:142718326-142718348 TAAAACAGTTTGTTTAAAACTGG + Intronic
983580518 4:169305277-169305299 GAAAAGCTCCAGTATAAAACTGG + Intergenic
984239618 4:177201915-177201937 TTAAACATTTTGTAAAAAACTGG - Intergenic
984990165 4:185372671-185372693 GGAAACCTCTTTTATAAAAAGGG - Intronic
985241206 4:187932624-187932646 GAAATCATATTATATAATACTGG + Intergenic
985774890 5:1836171-1836193 GAAGACAACTTGTAAATAACAGG - Intergenic
986408600 5:7452399-7452421 TGAAGCAACTTGTATAAAACTGG - Intronic
986632479 5:9787317-9787339 GAAAACATCATGAAAAAGACAGG + Intergenic
986935091 5:12874214-12874236 TAAAACATGTTGTTTAAAACAGG - Intergenic
987286624 5:16464343-16464365 GAAAACTTCATCTATAGAACAGG + Intronic
988232377 5:28496695-28496717 GAAAACATTTGGTATAAGCCAGG - Intergenic
989428222 5:41320907-41320929 TAAAAAATCTTTTAAAAAACTGG + Intronic
990474388 5:56147578-56147600 GAGAACATCTTGAAAATAACTGG + Intronic
990670000 5:58117614-58117636 GATAACATCTTTTAGAAATCTGG - Intergenic
993194804 5:84727938-84727960 GTGAACATCTTGCAGAAAACAGG + Intergenic
994088729 5:95789046-95789068 GAAAACTTCTTGTGTAACACAGG - Intronic
994475218 5:100259721-100259743 TAAAACATCTAGAATAAAATAGG - Intergenic
994882089 5:105511894-105511916 GAAAACCTTTTATGTAAAACTGG - Intergenic
997210883 5:132076112-132076134 TAAAACATCTTGAATAAATATGG - Exonic
997993839 5:138569853-138569875 TAAAACATTTTGTATACAACAGG + Intronic
998962613 5:147504747-147504769 GGAAACATCTTGCACAAAAGAGG + Intronic
999804008 5:155065295-155065317 GAAAACACTTTCTATAAACCTGG - Intergenic
1000252135 5:159505701-159505723 GAAAACATGATTTTTAAAACGGG + Intergenic
1000692471 5:164340672-164340694 CAAAACATTTTGCATAAAGCAGG + Intergenic
1001000018 5:167996613-167996635 CAATACATCTTGTCTAAAATAGG - Intronic
1001908789 5:175496452-175496474 TAAAACATCTTGTCTCAAATAGG + Intronic
1002027436 5:176404988-176405010 TTAAACCTCCTGTATAAAACAGG + Intronic
1005215144 6:23518022-23518044 GAAAACATCTATTAGAAAATAGG - Intergenic
1006199511 6:32275320-32275342 GAAAACATATAATACAAAACAGG - Intergenic
1008029790 6:46681610-46681632 GAAAATATCTGGTAACAAACAGG + Intergenic
1008639626 6:53448483-53448505 AAAAACATCTTCTATATAATGGG + Intergenic
1009312889 6:62178391-62178413 GAAAACATCATGTATTCTACAGG - Intronic
1010767283 6:79790331-79790353 ACTAACATGTTGTATAAAACTGG - Intergenic
1011237903 6:85237993-85238015 GCAAACATCTTATTTAACACAGG + Intergenic
1011571867 6:88746477-88746499 AAAATCATCTTACATAAAACTGG - Intronic
1012198323 6:96373404-96373426 GAACACTTCTTGAAGAAAACAGG + Intergenic
1012231949 6:96770257-96770279 GAAAACTTGTTTTATGAAACTGG - Intergenic
1013672126 6:112416032-112416054 ACTAACAACTTGTATAAAACAGG + Intergenic
1013880742 6:114896748-114896770 GAAAAATTATTTTATAAAACAGG - Intergenic
1014356417 6:120417117-120417139 TAAAACCACTTATATAAAACTGG + Intergenic
1014776557 6:125517707-125517729 GAATAAATCTTGATTAAAACAGG + Intergenic
1015349704 6:132203360-132203382 GAAACCATCTTTTTAAAAACAGG - Intergenic
1016367265 6:143333018-143333040 GTTAACATCTTGTATAATCCTGG - Intronic
1016731082 6:147428960-147428982 GAAAACATCTTTAATAAGTCTGG + Intergenic
1018530686 6:164759675-164759697 GGTAACATCTTGTATAACATTGG + Intergenic
1020620777 7:10516057-10516079 AAAAACAGCTGGTAGAAAACAGG - Intergenic
1021591154 7:22263907-22263929 GAAAAAAACTTTTATAATACAGG - Intronic
1021626885 7:22602390-22602412 GAAATCATCTTCCATGAAACTGG - Intronic
1022864122 7:34399678-34399700 GAGAACATCCTGTATGAAAGGGG + Intergenic
1023226856 7:37979176-37979198 AAAGGCATCTTGCATAAAACTGG - Intronic
1024033144 7:45482246-45482268 AAAAACATCTTGGAGACAACTGG - Intergenic
1026628538 7:72017812-72017834 GAAAACATCTCATGTAGAACTGG - Intronic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1030450195 7:109699555-109699577 CAAAACAGCTTGTATAAAAGTGG + Intergenic
1030529035 7:110689707-110689729 GAAAACATATATCATAAAACAGG - Intronic
1030750194 7:113223129-113223151 TAAAACCTCTTTTATAAAACTGG - Intergenic
1030857304 7:114575905-114575927 GTAAACAGCTTTTATAAAAAGGG - Intronic
1031460121 7:122038242-122038264 TAAAACATCTTGTACAAAATGGG + Intronic
1033994729 7:147331410-147331432 GTAAACACCTTGTATATAATTGG + Intronic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1035786126 8:2262651-2262673 GAAAACATTTTGTCTAAAAAGGG + Intergenic
1035806681 8:2459065-2459087 GAAAACATTTTGTCTAAAAAGGG - Intergenic
1036191305 8:6672933-6672955 GAAAACTTCTAGAAGAAAACAGG + Intergenic
1036238592 8:7063814-7063836 CAAAACCTCTATTATAAAACCGG + Intergenic
1037120162 8:15274777-15274799 CAAAACAGATTGTAGAAAACTGG - Intergenic
1038075188 8:24065328-24065350 GAAAACAGCTTTTGTGAAACCGG + Intergenic
1039544129 8:38396091-38396113 TAAAACTTCTAGAATAAAACAGG - Intronic
1039931322 8:41992524-41992546 TACACCATCTTTTATAAAACAGG + Intronic
1041249945 8:55924305-55924327 GAAAACAGATGGTATAGAACAGG - Intronic
1041806713 8:61858721-61858743 GAAGAGATATTTTATAAAACAGG + Intergenic
1043274784 8:78379391-78379413 GAAATCATTTTATTTAAAACTGG + Intergenic
1043513442 8:80973386-80973408 AAAAAAATTTTGCATAAAACAGG + Exonic
1043957721 8:86381357-86381379 GAAGAAATATTGTATGAAACAGG - Intronic
1044096870 8:88077751-88077773 GAAAACATCTTAACTACAACAGG - Intronic
1044253843 8:90036761-90036783 GAAAACATTATTTATAAAAATGG - Intronic
1044598394 8:93980269-93980291 AAAAAAATCTTGGATGAAACTGG - Intergenic
1046306041 8:112368274-112368296 GAAAATATCTTGTATAATTTAGG - Intronic
1047036292 8:120942406-120942428 CAAAACAACTTGAATAAAAATGG - Intergenic
1047594754 8:126367086-126367108 GATAACATCTTGTATATATTGGG - Intergenic
1048374929 8:133814931-133814953 GAAATCATCTGGTATAGAACTGG + Intergenic
1048720201 8:137314870-137314892 GACAACATTTTGTATAACCCCGG - Intergenic
1050806766 9:9690317-9690339 GAAAACATCTGTTTTAAAAATGG - Intronic
1050883504 9:10735245-10735267 GAAAACAAAATGTATAAAAAAGG - Intergenic
1051187761 9:14478489-14478511 AAAGAGATCTTGTATAAAAATGG + Intergenic
1051215981 9:14798194-14798216 GTAAACATTTTATATAAATCTGG - Intronic
1052985020 9:34480565-34480587 GAAAACATCATGTACAAAGTTGG - Intronic
1053500490 9:38585298-38585320 GAAAATCTGTTGTCTAAAACTGG - Intergenic
1057679884 9:97169723-97169745 GAAAATCTGTTGTCTAAAACTGG - Intergenic
1057813053 9:98272717-98272739 GAAGCCATCATATATAAAACAGG - Intergenic
1058127339 9:101210277-101210299 GAGATCATCTGGTATAAGACAGG + Intronic
1058467119 9:105240305-105240327 TAAAACTTCTGGTATAAAATAGG - Intergenic
1059092669 9:111377252-111377274 GGAAACATGTTGTATATAACAGG + Intronic
1059799572 9:117736673-117736695 GAAAACATATTCTAGAATACTGG - Intergenic
1061224562 9:129273255-129273277 GACAACAGCTTGTATTAAAGTGG - Intergenic
1062345791 9:136114491-136114513 GAAATCATCTTGTGTAAGATGGG - Intergenic
1186406182 X:9305534-9305556 GAAAACATCTTGTAAAAATAAGG + Intergenic
1186870659 X:13768042-13768064 TCAATCATCTTCTATAAAACAGG - Exonic
1186942858 X:14529653-14529675 GAAAACATTTTCTAGAAAAAGGG + Exonic
1186969654 X:14827650-14827672 GAAAACAATTTGTATTAAATGGG - Intergenic
1187745734 X:22407303-22407325 GAAAACATCATGTACCCAACAGG - Intergenic
1187917081 X:24163942-24163964 GAAAACAACTTGTATGAAAATGG - Intronic
1187973437 X:24681561-24681583 TAAAAAATCTAGTATAAAACAGG + Intergenic
1188047477 X:25443460-25443482 GTGAACAACTTTTATAAAACTGG + Intergenic
1188417359 X:29951982-29952004 GAAAACATCTTGCAGAAAGACGG + Intronic
1188598843 X:31935475-31935497 GAAAACGTCTAGTATAGTACAGG + Intronic
1189671311 X:43413202-43413224 TATAACATCATGAATAAAACAGG - Intergenic
1189907397 X:45775562-45775584 GAAAACAGCATGGATAATACTGG + Intergenic
1189947685 X:46195851-46195873 GAAAAAATTTTGAATAAAAATGG + Intergenic
1190067035 X:47248534-47248556 GAAAATATTTTGGAAAAAACTGG - Intergenic
1190692460 X:52922786-52922808 GAAAAAATCATGTAGAAAACCGG - Intergenic
1193776488 X:85649097-85649119 CAAAACATCTTGTATTAGTCAGG + Intergenic
1195955885 X:110329958-110329980 GAAAACATATGGTACAATACTGG - Intronic
1196939836 X:120764417-120764439 CAAATCATCTTTTAAAAAACTGG + Intergenic
1197680091 X:129373552-129373574 GGAATCATCATATATAAAACTGG + Intergenic
1201386661 Y:13447472-13447494 GATAACATCTTATATTAATCTGG - Intronic
1201942653 Y:19476530-19476552 CAAAACATCTTTTATAATGCAGG - Intergenic