ID: 923601693

View in Genome Browser
Species Human (GRCh38)
Location 1:235409241-235409263
Sequence ATTGGTAGGCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 756}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923601686_923601693 25 Left 923601686 1:235409193-235409215 CCACAAGGGCCATGGGTCAGGAT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 57
4: 756
923601689_923601693 -8 Left 923601689 1:235409226-235409248 CCAGCAGCATGTGTAATTGGTAG 0: 1
1: 0
2: 3
3: 6
4: 79
Right 923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 57
4: 756
923601687_923601693 16 Left 923601687 1:235409202-235409224 CCATGGGTCAGGATGATGATTTT 0: 1
1: 0
2: 1
3: 13
4: 158
Right 923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 57
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923601693 Original CRISPR ATTGGTAGGCAGAAGGAGGA AGG Intronic
900840723 1:5046650-5046672 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
901094191 1:6665173-6665195 CTTGGGAGGCAGACGAAGGAGGG - Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901609427 1:10485559-10485581 TTTGGGAGGCAGAGGTAGGAGGG - Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
901753468 1:11426584-11426606 AGTGGAAGGCAAAAGGAGGTAGG - Intergenic
902210234 1:14899702-14899724 AGTGGTGGACAGAGGGAGGAGGG - Intronic
902427903 1:16339152-16339174 AGTAGGAGGCAGAAGCAGGAAGG - Intronic
903106999 1:21089864-21089886 AATGGCAGGCAGAATTAGGAAGG - Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903428629 1:23274155-23274177 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
903661249 1:24980199-24980221 TTAGGGAGGCAGAAGCAGGAGGG - Intergenic
904716152 1:32469086-32469108 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
904805431 1:33128119-33128141 TTTGGGAGGCCGAAGGTGGAAGG + Intergenic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
905822766 1:41006624-41006646 ACTGTTAGGCACATGGAGGAGGG + Intronic
906331790 1:44891367-44891389 TTTGGGAGGCTGAAGCAGGAAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907698987 1:56765102-56765124 ACTGCTGGGCAGAAGTAGGAAGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
908716173 1:67072045-67072067 ATTGCAAGCCAGAAGGAGGGGGG - Intergenic
909801016 1:79806910-79806932 ATTCCTAGGCAGAAAGAGGTGGG - Intergenic
909909899 1:81247241-81247263 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
910260365 1:85288284-85288306 CTTGGGAGGCTGAAGCAGGAAGG + Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911570341 1:99511439-99511461 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
911841712 1:102690215-102690237 ATTTTTAGGCAAAAAGAGGAAGG + Intergenic
912626111 1:111205307-111205329 AGAGGTAGGCAGAGGGAAGAAGG + Intronic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
914227153 1:145730078-145730100 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914417409 1:147496694-147496716 ATTGGTGGGAAGTAGGAGGGAGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
915066225 1:153226467-153226489 ATTGGATGGGAGAAGAAGGAAGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915136657 1:153736686-153736708 TTTGGGAGGCAGAGGGAGGGTGG - Intronic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
916602579 1:166307435-166307457 ATTGGCAGGCAACAGGAGGTCGG - Intergenic
917204257 1:172553967-172553989 ATCTGTAGGCAGAAGGACTAAGG + Intronic
917218854 1:172706241-172706263 GGTGGTAGGGAGGAGGAGGAGGG - Intergenic
917353469 1:174102383-174102405 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
918431453 1:184465011-184465033 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
918567737 1:185952208-185952230 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
918778178 1:188665352-188665374 ATTAGTAGACAGGTGGAGGAAGG - Intergenic
918978582 1:191525016-191525038 ATTGGGAGGCTGAGGTAGGAAGG + Intergenic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919890729 1:201972268-201972290 TTTGGGAGGCTGAAGCAGGAAGG + Intergenic
920012846 1:202882135-202882157 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920143589 1:203839282-203839304 CTTGGGAGGCTGAAGAAGGATGG - Intronic
920362160 1:205426561-205426583 ATTGGCAGGAAGCAGAAGGATGG + Intronic
920389402 1:205589693-205589715 TTTGGTAGGCTGAGGCAGGAAGG - Intronic
920647917 1:207816866-207816888 ATTGGCTGGCAGTGGGAGGATGG - Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921261958 1:213392408-213392430 ATTGGCAGGTGGGAGGAGGAGGG + Intergenic
921538391 1:216381579-216381601 AGTGGTAGCTAGAAAGAGGAGGG - Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922048350 1:221967758-221967780 ATTGCTAGGCAGGTGGGGGAGGG - Intergenic
922223220 1:223624604-223624626 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923127049 1:231041163-231041185 AGTGGGAGGCAGCAGGAGGCGGG - Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923455703 1:234163328-234163350 AGTGTTAGGGAGAAAGAGGAGGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924628773 1:245717193-245717215 ATAGGGAGGAAAAAGGAGGATGG + Intergenic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063509663 10:6633503-6633525 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1063527743 10:6801000-6801022 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1064318855 10:14282837-14282859 AGCAGTAGGCAGAAGGAAGAAGG - Intronic
1064714020 10:18156784-18156806 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065821768 10:29532351-29532373 ATTAGTAGGCAGAAGCAGAGTGG + Intronic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066103461 10:32137597-32137619 ATTGTTGGGCAGGTGGAGGAGGG + Intergenic
1066535182 10:36383481-36383503 AGTGGGAGGTAGATGGAGGAAGG - Intergenic
1066642838 10:37573650-37573672 AGTGGGAGGTAGATGGAGGAAGG - Intergenic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068058410 10:52037672-52037694 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
1068128906 10:52873071-52873093 ATTGATAGACAGGAGGAGCAGGG + Intergenic
1068414276 10:56697382-56697404 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068646009 10:59469129-59469151 ATTGGGTGGGAGTAGGAGGAAGG + Intergenic
1069020800 10:63486277-63486299 ATTGGGAGACAGAAGAAGCATGG + Intergenic
1069048817 10:63770734-63770756 ACAGGTAGGCAGCAGGAAGAAGG - Intergenic
1069082253 10:64100978-64101000 ATTGGGAGGCCAAGGGAGGAGGG - Intergenic
1069362608 10:67660321-67660343 ATTGTTGGGGAGAAGCAGGAGGG - Intronic
1069524255 10:69153594-69153616 TTTGGGAGGCAGAGGCAGGAAGG - Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069860814 10:71470446-71470468 ATTGCTAGGGGGTAGGAGGAAGG - Intronic
1070211225 10:74324270-74324292 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070522270 10:77264383-77264405 AGTGTGAGGCTGAAGGAGGAAGG - Intronic
1071002830 10:80850184-80850206 ATTGTTAGACAGAAGGAGTAAGG + Intergenic
1072279335 10:93851856-93851878 TTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1073393392 10:103197921-103197943 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1073555526 10:104447258-104447280 ATTGGGAGGCTGAGGCAGGAGGG - Intronic
1073643911 10:105279915-105279937 TTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1073788434 10:106915504-106915526 ACAGGTAGGGAGGAGGAGGAGGG - Intronic
1073933151 10:108599599-108599621 ATTGTTAGGCAGCTGGGGGAGGG - Intergenic
1074441428 10:113480435-113480457 TTAGGTAGGAAGAAGGAGAATGG + Intergenic
1075133414 10:119760329-119760351 CTTGGGAGGCTGAAGGAAGAAGG + Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076565894 10:131398852-131398874 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1077850855 11:6073747-6073769 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1077879456 11:6337322-6337344 TTTGGGAGGCAGAAGCAGGAAGG - Intergenic
1078034770 11:7791856-7791878 ATTGGTGGGTACCAGGAGGAGGG + Intergenic
1078046186 11:7916071-7916093 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1078409147 11:11097400-11097422 ATTACTAGGCAGGAGGATGAAGG - Intergenic
1078601365 11:12734025-12734047 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079206319 11:18417823-18417845 ATTGGGAGGCTGATGTAGGAGGG + Intronic
1079323939 11:19475659-19475681 AGTGGTAGGCAGAACCAGGCAGG - Intronic
1079640951 11:22804775-22804797 ATTGGTAGGCTGATGGAGGGTGG + Intronic
1079779265 11:24578767-24578789 ACTAGAAGGCAGAAGGAGGGAGG + Intronic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080512808 11:32991664-32991686 CTTGGTAGGCAGAAGAAATATGG - Intronic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1082260224 11:50072475-50072497 ATTGGGAGGCAGGAGGAGCTGGG + Intergenic
1082260623 11:50074202-50074224 ATTGGGAGGCAGGAGGAGCTGGG + Intergenic
1085298984 11:75447651-75447673 AGTGGTATGCTGAAGCAGGAAGG - Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086588900 11:88488387-88488409 TTTGGGAGGCGGAAGTAGGAGGG - Intergenic
1086825826 11:91494762-91494784 ATTGGTAGGAAGAGGAAAGAGGG - Intergenic
1086835430 11:91615284-91615306 AGTTGTATGCAGTAGGAGGATGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087187826 11:95220399-95220421 ACTGGTTGGCAGGAGGGGGAGGG + Intronic
1087551037 11:99648898-99648920 AATGGTAGGAAGAAGCAGGGAGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1089100093 11:115955720-115955742 TTTCTTAGGGAGAAGGAGGAGGG - Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1090483906 11:127094781-127094803 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091129196 11:133129798-133129820 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1091226730 11:133961425-133961447 ATTGGGAGGCTGAGTGAGGATGG - Intergenic
1091440887 12:511308-511330 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091441254 12:512820-512842 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092611493 12:10178001-10178023 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1092739386 12:11613605-11613627 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1092789648 12:12060200-12060222 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1092955814 12:13548716-13548738 ATTGGGAGGCAAAAGGACAAGGG + Exonic
1093071222 12:14708779-14708801 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1093846981 12:23984450-23984472 ATTGGTTGGTTGAAGGAGGTTGG + Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094700820 12:32869099-32869121 GTTGGTAGGCAGGAGGAGGGAGG - Intronic
1094741906 12:33299298-33299320 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1095250748 12:39976638-39976660 CTTGGGAGGCTGAAGCAGGAAGG - Intronic
1095727474 12:45469373-45469395 ATTCCTAGGCGGAAGGGGGAAGG + Intergenic
1096205365 12:49717075-49717097 ATTGGGAGGCTGAGGCAGGATGG - Intronic
1096276336 12:50211398-50211420 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1097023102 12:56034721-56034743 ATTGGTGGGTGGAAGGCGGAGGG - Exonic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1097599579 12:61673999-61674021 AATGGAGGGCTGAAGGAGGAAGG + Intergenic
1097892606 12:64793095-64793117 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1098173702 12:67770557-67770579 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1099732775 12:86526275-86526297 ATTGGTTGGTAGGGGGAGGAGGG + Intronic
1100214379 12:92432743-92432765 GTTGGTGGGCAGAAGTTGGAAGG - Intergenic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100796354 12:98185839-98185861 TTGGGTAGGCAGCAGAAGGAAGG - Intergenic
1100836394 12:98570978-98571000 ATTGGACGGCAGGAGGAGGATGG + Intergenic
1100891588 12:99132005-99132027 GTTGGTAGGCAGCTGGGGGAGGG - Intronic
1101031389 12:100663996-100664018 ATTCATAGGCAGAAGAAAGATGG + Intergenic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102467960 12:113141560-113141582 TTTGGGAGGCCGAAGCAGGAGGG - Intergenic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1104179075 12:126360705-126360727 ACTGGTGGGGAGAAGGATGAGGG + Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104792003 12:131488924-131488946 GTTGGTAGGCAGGAGTGGGAAGG - Intergenic
1104953238 12:132451676-132451698 GTTGGAAGGCAGAGGGCGGAGGG + Intergenic
1105211708 13:18260986-18261008 TTTGTTAGGCAGAGAGAGGAAGG - Intergenic
1106050023 13:26181070-26181092 ACTGGAAGGCTGATGGAGGAAGG - Intronic
1106526982 13:30549635-30549657 TTTGGGAGGCCGAAGCAGGAGGG - Intronic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1106937082 13:34734853-34734875 ATTGGTGGGGAGAGGGAGCAAGG + Intergenic
1107075517 13:36318244-36318266 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1107435121 13:40375086-40375108 ATTGATAGGCAGTGGGAGGGAGG - Intergenic
1107683204 13:42871323-42871345 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1108716854 13:53088655-53088677 ACTGGTAGGAAGAGGGAGGCAGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108919606 13:55658884-55658906 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1108947374 13:56042114-56042136 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1108961025 13:56229730-56229752 AGTGGTAGGTTGAAGGAGCAAGG + Intergenic
1109473624 13:62846908-62846930 AGAGGCAGGGAGAAGGAGGATGG - Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109775175 13:67031460-67031482 TTTGGTAGACAGAAGCAGGCGGG + Intronic
1110284629 13:73735187-73735209 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111475097 13:88735490-88735512 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1112150759 13:96760411-96760433 GTTGGTAGGCAGAAGTAAAATGG - Intronic
1112345372 13:98584862-98584884 ATTAGTACTCAGCAGGAGGAGGG + Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114287761 14:21261068-21261090 ATTGGAAGGCTGAGGCAGGAGGG - Intronic
1114348927 14:21828331-21828353 TTTTGTAGGTAGAAGGAGTAGGG + Intergenic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1114616484 14:24071450-24071472 ATTGGGAGGGAGAAGAGGGAAGG - Intronic
1115237275 14:31219810-31219832 TTTGGTAGGCTGAGGCAGGAGGG + Intergenic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1116019029 14:39439647-39439669 ATTGGTAGGAATATGGAAGAGGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116179614 14:41517739-41517761 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1116360491 14:43989734-43989756 ATTGGTAGACAAAAAGAGGAAGG + Intergenic
1116613450 14:47105983-47106005 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117381203 14:55165413-55165435 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1118163970 14:63317793-63317815 ATAGCCAGCCAGAAGGAGGAGGG + Exonic
1118649742 14:67877905-67877927 TTTGGGAGGCGGAAGCAGGAGGG - Intronic
1119663946 14:76470933-76470955 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1119726163 14:76922939-76922961 ATAGGAGGGAAGAAGGAGGAGGG - Intergenic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120852581 14:89184810-89184832 ATAGGATGGCAGAAGGATGACGG - Intronic
1121144645 14:91573745-91573767 GTTGGTAGGGAGAAAGAGGCTGG + Intergenic
1122040934 14:98987002-98987024 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122491602 14:102120119-102120141 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1124832330 15:33161330-33161352 ATTGGAGGGCAGATGGAAGAGGG + Intronic
1125206610 15:37160754-37160776 TTTGGGAGGCCGAAGCAGGAGGG + Intergenic
1125277265 15:38006173-38006195 ATCAGGAGGCAGAAGCAGGAAGG + Intergenic
1125540750 15:40468595-40468617 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1125785919 15:42317960-42317982 ATTGGATGGGAGACGGAGGAGGG - Intronic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1127503507 15:59576632-59576654 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128435780 15:67646106-67646128 AGTGGTAAGAAGAAGGAGGTGGG + Intronic
1128568615 15:68717429-68717451 ATAGGTGGGGAGAAGGAAGACGG + Intronic
1129194463 15:73955804-73955826 AATGGGAGGTAGAAGGAGGCTGG + Intergenic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129508370 15:76101970-76101992 ATCTGTATGCAGTAGGAGGAAGG - Intronic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1131666792 15:94579511-94579533 AGTGGCAGGCAGATGGAGGAAGG + Intergenic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133392717 16:5422645-5422667 ATTGGGAGGAAAGAGGAGGAGGG + Intergenic
1133460706 16:5984077-5984099 AGTGGGAGGGAGGAGGAGGAGGG - Intergenic
1133651338 16:7816505-7816527 ATTGTTGGGCAGGAGGGGGAGGG - Intergenic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134342240 16:13356475-13356497 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1135509171 16:23067658-23067680 ATTAGTGCGTAGAAGGAGGAAGG - Exonic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136042140 16:27588132-27588154 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136529892 16:30860981-30861003 ATTGTTGGGCAGATGGGGGAGGG - Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137623392 16:49891810-49891832 TTTGGGAGGCCGAAGCAGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138293864 16:55870337-55870359 AGAGGAAGGGAGAAGGAGGAAGG + Intronic
1138804886 16:60080636-60080658 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1140143921 16:72286936-72286958 ATTGGAAGGGAGGAGAAGGAAGG - Intergenic
1140733826 16:77880262-77880284 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141571804 16:84938638-84938660 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142417541 16:89950735-89950757 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1203143820 16_KI270728v1_random:1786438-1786460 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1142634874 17:1250806-1250828 ATTGTTAAGCATAAGGATGAAGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1146328582 17:31908480-31908502 ATTGGAAGGCAGAATGAGAAGGG - Intergenic
1146396588 17:32472777-32472799 TTTGGGAGGCAGAAGCAGGAGGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148791222 17:50174074-50174096 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1150860554 17:68796530-68796552 ATTGTTGGGCAGATGGGGGAGGG + Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151446867 17:74172070-74172092 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1151470258 17:74313654-74313676 TGTGGCAGGCAGGAGGAGGAAGG - Intronic
1152157052 17:78641353-78641375 ATTGGCAGTCAGAGGCAGGAGGG - Intergenic
1154096698 18:11423527-11423549 ATTAGAAGGCAGAAGATGGAGGG - Intergenic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1155377558 18:25176974-25176996 AGATGTAGGCAGAAGGAGAAGGG - Intronic
1155503887 18:26514308-26514330 CTTGGGAGGCTGAAGTAGGAGGG + Intronic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1155734186 18:29200847-29200869 TTTGGTGGGGAGAAGCAGGAGGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157203891 18:45682365-45682387 ATTGGTCGTCAGGAGCAGGAAGG - Exonic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158051886 18:53232185-53232207 ATTGGTGGAGAGAAGGGGGAGGG - Intronic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1161661654 19:5550275-5550297 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1161711148 19:5848853-5848875 ACTGTTGGGCAGATGGAGGAGGG - Intronic
1161717937 19:5887246-5887268 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1162224651 19:9210362-9210384 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1162295109 19:9807970-9807992 CTTGGGAGGCTGAAGTAGGATGG + Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1163263572 19:16205430-16205452 ATTGCCAGGCAGCAGGAGGGAGG + Intronic
1163493854 19:17633220-17633242 TTTGGCAGGCAGAAGGCAGATGG + Intronic
1164866466 19:31608347-31608369 AGTGGCTGACAGAAGGAGGAAGG + Intergenic
1165045183 19:33098960-33098982 ATAGGGAGGCAAAAGGAAGAAGG - Intronic
1166031275 19:40131916-40131938 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1166305140 19:41933050-41933072 ATTGGTGGGCAGATGGACGGAGG + Intergenic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1166760129 19:45218853-45218875 TTTGGTAGGCCGAGGCAGGAGGG + Intronic
1166923876 19:46252064-46252086 TTTGGGAGGCCGAAGGAGGGTGG - Intergenic
1167119640 19:47508841-47508863 TTTGGGAGGCCGAAGCAGGAGGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168563443 19:57403194-57403216 ATTGCTAGGCAGACTAAGGACGG + Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925745279 2:7038751-7038773 ATTGATGGGCAGATGGATGATGG + Intronic
925847117 2:8044222-8044244 AGAGGAAGGGAGAAGGAGGAAGG - Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
926650476 2:15338765-15338787 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
926686560 2:15702891-15702913 ATTGGGAGGCAGAGGAAGCAAGG - Intronic
926815612 2:16795847-16795869 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
927228871 2:20799991-20800013 ATTGCAAGGCAGTAGGAGAAAGG + Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928985933 2:37181622-37181644 TTTGGGAGGCCGAAGCAGGAGGG - Intronic
929521385 2:42654910-42654932 ATTAGTAGAAAGAAGGAGGCTGG - Intronic
929938772 2:46314726-46314748 ATTGGTCGGGAGCTGGAGGAAGG + Intronic
930101719 2:47608584-47608606 ATTGGTTGGAAGAAGGACGATGG - Intergenic
930854684 2:56001326-56001348 ATTATTAGGCAGAAGAAAGATGG - Intergenic
931252754 2:60548997-60549019 ATTGTTGGGGCGAAGGAGGATGG - Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931369239 2:61646865-61646887 ATTGGTTGCCAGAAGGAGGAGGG + Intergenic
932974012 2:76577758-76577780 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
933087765 2:78077202-78077224 TTTGGGAGGCTGAAGTAGGAGGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933340335 2:81017649-81017671 ATTTGTAGGCAGACAGAGGTGGG + Intergenic
933870342 2:86559798-86559820 ATTCATAGGCAGGAAGAGGATGG + Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934863569 2:97786011-97786033 AGGGGTAGGCTGAAGAAGGAGGG + Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
935729044 2:106049753-106049775 TTTGGGAGGCTGAAGGAGGGGGG + Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936514695 2:113174259-113174281 AGGGGTAGGCTGAGGGAGGAGGG - Intronic
937433637 2:121862110-121862132 TTTGGTAGGCTGAGGCAGGAGGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937554818 2:123141035-123141057 TGTGGTAGGGAGAAGGGGGAGGG - Intergenic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
938222119 2:129578539-129578561 ATTGCTGCGGAGAAGGAGGAAGG + Intergenic
938813851 2:134879389-134879411 ATTAGTAGGAGGAAGTAGGAAGG - Intronic
938842079 2:135173705-135173727 ATTGGTGGGCAGGATGTGGAAGG + Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939181201 2:138804288-138804310 ATTGCAAGGCAGAAGGAGTTTGG + Intergenic
939327497 2:140712531-140712553 ACTGGTTGGAAGAAAGAGGATGG - Intronic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939933782 2:148263349-148263371 ATTGGGAGGCAGAGAGAGGGAGG + Intronic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940903137 2:159145165-159145187 TTTGGTAAGCAGAAAAAGGAAGG + Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
942286541 2:174423264-174423286 ATTTGTACGAAGAAGGAGTAGGG - Intronic
942841902 2:180372057-180372079 ATTGGTAGGAATAAGGACCAAGG + Intergenic
943412990 2:187564384-187564406 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
943739528 2:191396301-191396323 ATTGGTTTCCAGAAGGAGTATGG + Intronic
944553027 2:200863314-200863336 TTTGGGAGGCCGAAGCAGGAGGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
948062938 2:235055123-235055145 GTTGGAAGGGAGCAGGAGGAAGG + Exonic
948223200 2:236289651-236289673 GTTGGTGGTGAGAAGGAGGAGGG + Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169477745 20:5947941-5947963 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1170029826 20:11933082-11933104 ATTGGCTGGAAGAGGGAGGAAGG + Intergenic
1170121672 20:12919156-12919178 ATTGTTAGGCAGAAGGAGCGAGG - Intergenic
1170199298 20:13725231-13725253 ATTTGGTGGCAGAAGGATGAGGG - Intronic
1170837605 20:19897954-19897976 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1171060084 20:21948352-21948374 ACTTGTAGGCATAAGAAGGAGGG - Intergenic
1173102898 20:40104196-40104218 AATGGAAGGAAGAAGGAGGTGGG - Intergenic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1173837657 20:46136344-46136366 ATTGGGGGTCAGGAGGAGGAAGG + Intergenic
1173958234 20:47051330-47051352 ATTGGGAGGAAGAAGTAGGGGGG + Intronic
1174199278 20:48795686-48795708 AATGGTAGGCAGAAGTCAGAAGG + Intronic
1174253525 20:49236953-49236975 TTTGGGAGGCAGAAGGTGGGTGG - Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175089493 20:56490117-56490139 ATTGCTAGACAGAAGGAAAAGGG - Intronic
1175134794 20:56815145-56815167 ATTGGAAGAGAGGAGGAGGAGGG + Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176989528 21:15478573-15478595 ATTACTAGGCAGAAGCAGTATGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178199930 21:30391746-30391768 ATTGGGAGGCAGAAGAAAAAGGG - Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1179387490 21:40956754-40956776 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1180234610 21:46450266-46450288 ATTAGGAGGCAGAGAGAGGATGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180696747 22:17756107-17756129 TTTGGGAGGCCGAAGGAGGGTGG - Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1181295118 22:21831731-21831753 ACTGGTAGGCAGGAGAAGAAGGG - Intronic
1181333170 22:22110300-22110322 ATAGCTAGACAGAAGCAGGAGGG - Intergenic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181701040 22:24621387-24621409 TTTGTTAGGCAGAGAGAGGAAGG + Intronic
1182078183 22:27509406-27509428 AGTGGTAGGCAGAGAGAGGCTGG - Intergenic
1182079467 22:27518750-27518772 AGTGGTAGCCAGAGGCAGGAGGG - Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182432950 22:30311344-30311366 GTTGGTAGGAAAAAGGAAGAGGG + Intronic
1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG + Intergenic
1183174211 22:36210870-36210892 ATTGGGAGGCTGAAGCAGAAGGG - Intergenic
1183759569 22:39803917-39803939 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1184064072 22:42105963-42105985 ATTGGGAGCCAGAAGCTGGATGG + Intergenic
1184125873 22:42486651-42486673 CTTGGGAGGCTGAAGCAGGATGG + Intergenic
1184145738 22:42609252-42609274 TTTGGGAGGGCGAAGGAGGAAGG + Intronic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
949783720 3:7717946-7717968 ATTGTAAGGCAGAAGGGTGAAGG - Intronic
949789334 3:7775811-7775833 ATGGGTAGTCAGAAGTAGGTAGG + Intergenic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950538716 3:13597172-13597194 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
951072423 3:18347175-18347197 GATGGTAGGCAGAAAGAGAAGGG + Intronic
951504458 3:23427320-23427342 TTTGGGAGGCAGAGGCAGGAAGG + Intronic
952226446 3:31381733-31381755 ATTGGGAGGCAGTAGAAGAAGGG + Intergenic
952398674 3:32943515-32943537 GTTGGTAGGCTGAGGCAGGAGGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953516889 3:43602176-43602198 ATTTGTGGAAAGAAGGAGGAGGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955253302 3:57305473-57305495 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
956162709 3:66371852-66371874 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956205363 3:66749512-66749534 AGTGGTAGGCAGAAAGGGGTAGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956389905 3:68760508-68760530 AGTGCTGGGCAGGAGGAGGAAGG - Intronic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
957026253 3:75185675-75185697 ATTGGCAGGCAGCTGGATGATGG - Intergenic
957274315 3:78070817-78070839 AGTAGTAGGAAGAAGGATGACGG + Intergenic
957295179 3:78325683-78325705 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958258326 3:91350993-91351015 ATTGGGAGGCAGAGAAAGGAGGG - Intergenic
958636214 3:96750427-96750449 ATTCCTGGGCAGAAGGGGGAGGG + Intergenic
959288414 3:104443824-104443846 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
959650234 3:108744225-108744247 GTTGGGAGGCAGAGGGAGAAAGG - Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
963336771 3:143984354-143984376 ATAGGTAGGCATAGTGAGGAAGG - Intronic
963337551 3:143993891-143993913 AGTTGTAGGGAAAAGGAGGAGGG + Intronic
963663277 3:148153454-148153476 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
963684270 3:148416151-148416173 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964004688 3:151813031-151813053 AGCGGTAGCGAGAAGGAGGAGGG - Intergenic
964049672 3:152375080-152375102 CTTGGGAGGCTGAAGAAGGAAGG - Intronic
964524924 3:157607931-157607953 GATGGTTGGCAGAAGGAGGGAGG - Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965079537 3:164019668-164019690 AGTGGTAGTGAGAAGGAGGAGGG + Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965521720 3:169674765-169674787 ATTGGGAGGCAGAGGCAGGCAGG - Intergenic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967217074 3:187219950-187219972 ATGGATAGGCCGAAGGAGGGGGG + Intronic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
968191068 3:196667768-196667790 GTTGCTTGGCTGAAGGAGGAAGG - Intronic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261111 3:197324817-197324839 ATTGGAAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968971187 4:3796073-3796095 AAAGGTGGGCAGAAGGAGAAGGG - Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
969500215 4:7548127-7548149 ATTGCTGGGCTGAAAGAGGAAGG + Intronic
969507204 4:7595475-7595497 ATTGGTACCCAGAAGGACCAAGG - Intronic
969654170 4:8486756-8486778 ATTGCTGGGCAGATGGGGGAGGG + Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970719243 4:18966957-18966979 ATTTGTAGGAAGAAAGAGGGAGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
970831686 4:20347121-20347143 ATTAGTAGCCAGATGGAAGATGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971200071 4:24502811-24502833 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
973194324 4:47422402-47422424 ATTGGTAGCAAGGAGGAGAAGGG - Intronic
973769728 4:54195417-54195439 AGTGGAAGGCAGATGAAGGAGGG + Intronic
975382384 4:73716597-73716619 ATTGGTTTGCTGAAGGAAGAGGG - Intergenic
975455379 4:74584382-74584404 AGTAGTAGGCAGAGGGAGGGAGG + Intergenic
975572262 4:75829960-75829982 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
975635889 4:76447710-76447732 AGTGTAAGGCAGCAGGAGGAAGG + Intronic
975865151 4:78717768-78717790 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
975933952 4:79557888-79557910 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
976583643 4:86769405-86769427 TTTGGGAGGCCGAAGTAGGAGGG - Intronic
976696472 4:87923669-87923691 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
976884635 4:89968703-89968725 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
977062572 4:92275402-92275424 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
977075270 4:92442870-92442892 ATTGTTGGGCAGGAGGGGGAGGG + Intronic
977369779 4:96120960-96120982 ATTGGTAAGCAGTAGAAGTAAGG + Intergenic
977446501 4:97138536-97138558 ATTGTTGGGCAGGTGGAGGAGGG + Intergenic
977744137 4:100525122-100525144 TTTGGGAGGCAGAAGGTGGGAGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978096401 4:104784284-104784306 ATTGGAAGGCAAAAGGTGGGAGG - Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
979133288 4:117076001-117076023 ATTGGTGGAGAGAAGGAGAAAGG - Intergenic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979850370 4:125565546-125565568 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
980198813 4:129626967-129626989 ATGGGTAGGTAGAGGGAGAATGG + Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980687489 4:136248356-136248378 ATTGTTGGGAAGAAGGAGGCAGG + Intergenic
980721376 4:136700025-136700047 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
980915652 4:139031083-139031105 ATTGGTGGGCAGCTAGAGGAAGG + Intronic
981227886 4:142318269-142318291 AGTGGAAGGCAGAGGAAGGAAGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982441813 4:155444297-155444319 ATAGGTAGGCAGAATGAGAATGG - Intergenic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
983032071 4:162815123-162815145 ATTGGGAGGCTGAGGCAGGAGGG - Intergenic
983032113 4:162815621-162815643 ATTGGGAGGCCGAGGCAGGAGGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
984014811 4:174413441-174413463 ATTGGTAGCTTGATGGAGGATGG + Intergenic
984053402 4:174895559-174895581 ATTGGAGGGTAGAAGGTGGAGGG + Intronic
984700603 4:182816322-182816344 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985693412 5:1326111-1326133 AGTGGCAGGCAGAAGTAGGTGGG - Intronic
986919649 5:12666450-12666472 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987248496 5:16075384-16075406 AGTGGTGGGCAGTAGAAGGAGGG - Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987904095 5:24052696-24052718 GTTGGAAGGCAAAAGGAGAATGG - Intronic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989418989 5:41213432-41213454 ATAGGTATGCAGAATGAAGAGGG + Intronic
990468958 5:56095727-56095749 ATTGGAAGGTGGGAGGAGGACGG - Intergenic
990565190 5:57020927-57020949 ATTGTTGGGCAGGTGGAGGAGGG + Intergenic
990916832 5:60915737-60915759 AGTGGGAGGCAGAAGGAGACGGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992826504 5:80554653-80554675 GTTGGGAGGCAGGAGGAGCAAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993452806 5:88093400-88093422 ACTGGTTGGCAGAAGGATAATGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
994065042 5:95529779-95529801 ATTGGGAGGGAGAGGGAGGGAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995535505 5:113131725-113131747 TTTGGAAGGCAGAGGGAGGTGGG - Intronic
996203322 5:120701501-120701523 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
996745510 5:126843469-126843491 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
997016694 5:129944230-129944252 ACTGGTAGGTGGAAGAAGGAGGG + Intronic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
997769739 5:136543522-136543544 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
997772703 5:136569242-136569264 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
998391087 5:141787357-141787379 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
1000235800 5:159359377-159359399 ATTGGTAGGTACAAGGAGCTAGG + Intergenic
1000269444 5:159669636-159669658 ATAAGTAGGCACAAGGAGAAAGG + Intergenic
1000439657 5:161250266-161250288 ATTGCTGGGCAGATGGGGGAGGG - Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001391759 5:171385313-171385335 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1001526132 5:172430235-172430257 ATTTGTAGGGAGAAGGAGCAGGG - Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003744830 6:8988826-8988848 CTTGGGAGGCTGAAGTAGGAAGG - Intergenic
1003765793 6:9234958-9234980 ATTGGGAGGCAAAAGAGGGAGGG + Intergenic
1003838725 6:10098475-10098497 ATTGGGAGGCCGAGGCAGGAGGG + Intronic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004491885 6:16125508-16125530 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1005968147 6:30742062-30742084 GTTGGTAGGGAGAGGGAGAAGGG + Intronic
1006180536 6:32151093-32151115 ATTGGAAGGAAGAAGGAGGGGGG - Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006502911 6:34469457-34469479 ATTGGCAGGCAGGTAGAGGAGGG + Intronic
1006757956 6:36433490-36433512 AATGGTAGGCAGATGGGGAAGGG + Intronic
1007005645 6:38359686-38359708 ATTAGCAGGGAAAAGGAGGAAGG + Intronic
1007258061 6:40542361-40542383 AATGCTGGGCAGGAGGAGGAGGG + Intronic
1007507218 6:42345052-42345074 ATTGTTAGGCAAAAGAAGGCAGG + Intronic
1007772214 6:44201114-44201136 ATTGGTGGGCAGAGGAATGATGG + Intergenic
1007794751 6:44338526-44338548 AATGGTAGGCAGAAGAAGCCTGG - Intronic
1007973883 6:46080623-46080645 ATTTGGAGGCAGTTGGAGGAGGG - Intergenic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009192433 6:60645603-60645625 ATTAGTAGGCAGAGGGAAAAAGG - Intergenic
1009480754 6:64155647-64155669 ATTGCTATGCAGAAAAAGGAAGG + Intronic
1009515384 6:64609639-64609661 TTTGGGAGGCTGAAGCAGGACGG + Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010419769 6:75659784-75659806 ATGGGTAGGCAGGAGGAAGGAGG - Intronic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1014657283 6:124123305-124123327 ATTGGAGGGGAGAAGGAGGCAGG + Intronic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1015323767 6:131903485-131903507 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1015455679 6:133424379-133424401 ATTCTTGAGCAGAAGGAGGAGGG - Intronic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1016248800 6:142017607-142017629 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1016354559 6:143204049-143204071 ATTTGTAGATAGAAGAAGGAAGG + Intronic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1020681189 7:11238827-11238849 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1022809620 7:33856072-33856094 ATTGCTATTCAGAAGGAGAAGGG + Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024516395 7:50262614-50262636 AGTGGAAGGCAGAAGAAGAAGGG - Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026602597 7:71789043-71789065 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1028589979 7:92483731-92483753 ATTGTTGGGCAGATGGGGGAGGG + Intergenic
1029141094 7:98410908-98410930 ATTGGGAGGCTGAGGTAGGAGGG - Intergenic
1029304680 7:99610283-99610305 ATTGGGGGGCAGAATGAGGGAGG + Intergenic
1029317035 7:99724694-99724716 ATTGTTGGGCAGGTGGAGGAGGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030172636 7:106619257-106619279 ATAGGTAGGCAGGAAGGGGAAGG + Intergenic
1030942417 7:115670499-115670521 ATAGTTACACAGAAGGAGGAAGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031738342 7:125395993-125396015 ATTGGAAGGCAGAGGGTGGGAGG + Intergenic
1031776261 7:125911788-125911810 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1032066203 7:128773481-128773503 TTTGGTAAGCACAGGGAGGAAGG - Intronic
1032240093 7:130153563-130153585 ACCGGTAGGAGGAAGGAGGAAGG + Intergenic
1032499612 7:132390700-132390722 GTTGGTGGGCAGAAGGGGGCTGG - Intronic
1034337378 7:150332251-150332273 ATTGGATGGGAGAAGAAGGAAGG + Exonic
1034477857 7:151297961-151297983 ATTGGCAGGCAGATGGAAGACGG + Intergenic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1035038047 7:155908162-155908184 AGAGGTAGGGAGAAGGGGGAGGG + Intergenic
1035279111 7:157766164-157766186 ATTGGTGGACAGATGGGGGATGG - Intronic
1035884950 8:3281657-3281679 ATTGCTAGGAATTAGGAGGAAGG + Intronic
1036281416 8:7404238-7404260 ATTGCTGGGCAGGTGGAGGAGGG - Intergenic
1036340051 8:7907334-7907356 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
1038164113 8:25068081-25068103 ATTCTTAGGCACATGGAGGAAGG - Intergenic
1038415077 8:27389239-27389261 ATAGGAAGGCAGAGAGAGGAGGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038736064 8:30170747-30170769 ATTGGGAGGCTGAGGCAGGAGGG - Intronic
1039697975 8:39932421-39932443 AGTGGTGGGCAGAAGCAGCAGGG - Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1041148819 8:54910575-54910597 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042420152 8:68578902-68578924 ATTGGAAAGCAAAAGGAGTATGG - Intronic
1042590493 8:70393444-70393466 TTTGGTAGGTAGATAGAGGATGG - Intronic
1042774727 8:72418073-72418095 ATTGTTGGGAGGAAGGAGGAGGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1044148577 8:88746126-88746148 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
1044837545 8:96311006-96311028 TTTGGGAGGCAGAAGGTGGGTGG - Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045197456 8:99945670-99945692 ATTGCTGGGCAGATGGGGGAGGG - Intergenic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1047464679 8:125100801-125100823 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1048360018 8:133689638-133689660 ATTGTTAGGCAGTAGGGGGTTGG + Intergenic
1048764302 8:137828757-137828779 ATTGCTAGGCAGGTGGGGGAGGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049491525 8:142905836-142905858 ATTAGTAGTAAGAAGGAAGATGG - Intronic
1049512195 8:143034082-143034104 TTTGGGAGGCAGAGGTAGGAGGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050328979 9:4526040-4526062 TTTGGGAGGCCGAAGCAGGAGGG + Intronic
1050429566 9:5548913-5548935 ATTGGAGGCCAGAAAGAGGACGG - Intronic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051589156 9:18758573-18758595 AGTGGGAGGAAGATGGAGGAAGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052576282 9:30295718-30295740 ATTGGTAGACATTAGAAGGAAGG - Intergenic
1052633590 9:31071757-31071779 ATTCCTGGGCAGAAGGAGGCAGG - Intergenic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1052955199 9:34248801-34248823 ATTGGTGGGGAGAGGGAGCATGG - Intronic
1054809253 9:69421903-69421925 AGTGGAAGGCGGAAGGCGGAAGG - Intergenic
1055019878 9:71658455-71658477 TTTGGGAGGCAGAGGAAGGAGGG - Intergenic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055356467 9:75442673-75442695 ATTGGAAGGCAGAGGGTGGGAGG - Intergenic
1055366409 9:75549107-75549129 TTTGGGAGGCCGAAGGTGGAAGG - Intergenic
1055664251 9:78537888-78537910 ATTGGGAGGCAGAAGATGGGAGG - Intergenic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1055809983 9:80139209-80139231 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1056323819 9:85460446-85460468 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056522378 9:87412726-87412748 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1056629353 9:88280397-88280419 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1056882915 9:90414375-90414397 ATTGCTGGGCAGGAGGGGGAAGG - Intergenic
1057199341 9:93132005-93132027 CGTGGCAGGCAGAAGGATGAGGG + Intronic
1057234780 9:93349405-93349427 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1057683934 9:97216643-97216665 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058680769 9:107438503-107438525 ATTGGCATGCAGATGGAGAAGGG - Intergenic
1058749246 9:108022935-108022957 AGTGGAAGGAAGAGGGAGGAGGG + Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059707005 9:116834803-116834825 ATTGGGAGGCTGAGGCAGGATGG + Intronic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060344405 9:122803764-122803786 ATTGGCCGGCAGAAGGAACAAGG - Intronic
1060580324 9:124739560-124739582 CTTGGGAGGCTGAAGTAGGAGGG - Intronic
1060597464 9:124856897-124856919 ATGGGTAGGTAGGAGCAGGATGG - Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061382577 9:130267051-130267073 CTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1061459922 9:130729340-130729362 AGAGGTAGGCAGAAGAAGGTGGG - Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1062282337 9:135757623-135757645 AATGGCTGGCAGGAGGAGGAGGG + Intronic
1062604647 9:137341071-137341093 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186112933 X:6276093-6276115 ATTGCTGGGCAGGTGGAGGAGGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1187469571 X:19556783-19556805 ATTGGGAGGCTGAGGCAGGAGGG - Intronic
1187794012 X:22981305-22981327 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188800813 X:34527505-34527527 ATTGGTAGGCACAGTGAGGCAGG - Intergenic
1189085316 X:38017128-38017150 ATTGGTTGGAAGAAGGAAGTGGG - Intronic
1189378079 X:40481213-40481235 ATTTGTGGGAAGATGGAGGAAGG - Intergenic
1189496890 X:41516669-41516691 ATAGGAAGCAAGAAGGAGGAGGG + Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1190288021 X:48973333-48973355 ATTGGTAGGTGGATAGAGGATGG - Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192319400 X:70077347-70077369 ATTGGCAGGCCTAAGGGGGAGGG - Intergenic
1192420693 X:71027480-71027502 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1192568414 X:72182297-72182319 TTTGGGAGGCCGAGGGAGGATGG + Intronic
1192695658 X:73412909-73412931 ATTGGTAGCCATATGGAGAATGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1194238567 X:91414996-91415018 TTTGGAAGGCAGAAGGGAGACGG - Intergenic
1194622137 X:96186527-96186549 ATTAGGAGGCAGGAGGAGAAGGG - Intergenic
1195291226 X:103433474-103433496 ATTGTTGGGCAGGTGGAGGAGGG + Intergenic
1196073020 X:111545718-111545740 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196165482 X:112532417-112532439 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196299948 X:114041785-114041807 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196330759 X:114468564-114468586 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196341780 X:114605211-114605233 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
1196430811 X:115623246-115623268 TTTGGTAGGCTGAGGCAGGAGGG + Intronic
1196681014 X:118469618-118469640 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1196752821 X:119132876-119132898 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1196935374 X:120725226-120725248 AATGGTGGGCACAAGGAGGCTGG - Intergenic
1197404235 X:126029916-126029938 ATTGGTAATCAGTGGGAGGATGG + Intergenic
1197695643 X:129547119-129547141 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1197712937 X:129685073-129685095 ATTGGTGGGCAGAGGGATGGTGG + Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic