ID: 923602778

View in Genome Browser
Species Human (GRCh38)
Location 1:235418167-235418189
Sequence TGCGAACTTAAAAAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923602778 Original CRISPR TGCGAACTTAAAAAAAAGGA AGG (reversed) Intronic
901101358 1:6721471-6721493 TGAGAACCTACCAAAAAGGAGGG - Intergenic
903104855 1:21068069-21068091 TGTGATCTTAACAAAAAGAAGGG + Intronic
908368812 1:63458654-63458676 TTGGAAGTTACAAAAAAGGAGGG - Intronic
908470864 1:64442613-64442635 TTAAAAGTTAAAAAAAAGGATGG - Intergenic
908490801 1:64642239-64642261 GGAGAACTGAAAAAAAAGGTGGG - Intronic
908744400 1:67361701-67361723 TGAGAAGGTAAAAAAAAGAAAGG + Intronic
910553960 1:88508839-88508861 TGCAAACTTTAAAAAAAAAAAGG + Intergenic
913256939 1:116962340-116962362 TAGGAACTTAAAAAAAATGCTGG + Intronic
913536634 1:119779189-119779211 TGCAAATTAAAAAAAAAGGGGGG - Intergenic
915329975 1:155105165-155105187 TAGGATCTTAAAAAACAGGAAGG - Intergenic
915568367 1:156729370-156729392 TGTCAGCTGAAAAAAAAGGAGGG - Intronic
917562350 1:176172391-176172413 TGCAAACTTAAAAATATGCACGG + Intronic
918520868 1:185413497-185413519 TGAGAACTTGAAAAAAGGTATGG - Intergenic
918712234 1:187745948-187745970 TGGGGACTGAAAAGAAAGGATGG + Intergenic
918900718 1:190413135-190413157 TGGGAACTTAACAGAAAGGAAGG + Intronic
919062281 1:192648728-192648750 TGGGATCTTAAATAAAAAGATGG - Intronic
919579195 1:199350058-199350080 TGACAACTTAAAGCAAAGGAGGG + Intergenic
919891053 1:201975123-201975145 TGCTAACATAAAAAAAAAAATGG - Intergenic
921689805 1:218135276-218135298 TGCTAACTTAAAATTATGGATGG - Intergenic
923220065 1:231884777-231884799 TCCGAACCTAAAATAAAAGATGG + Intronic
923602778 1:235418167-235418189 TGCGAACTTAAAAAAAAGGAAGG - Intronic
924653378 1:245949934-245949956 TGCAAATTTAAAAAACTGGAAGG + Intronic
1062899258 10:1129896-1129918 TTAGAAGTTAAAAAAAAGCATGG + Exonic
1063070202 10:2653975-2653997 TAGGAACTTAACAAAAATGATGG - Intergenic
1064581051 10:16793356-16793378 TGACAACTGAAAAAAAAAGATGG + Intronic
1065678507 10:28204670-28204692 TGCTAACATAAAAAAAATTATGG + Intronic
1066071683 10:31821685-31821707 TGTGAACTTAAACAAAAGTTAGG + Intronic
1068300143 10:55128227-55128249 TGCAAATAGAAAAAAAAGGATGG - Intronic
1072038393 10:91585083-91585105 TGCAACCTTTAAACAAAGGAGGG + Intergenic
1077717670 11:4598341-4598363 TTCGAACTTAGAATGAAGGAAGG - Intergenic
1079623881 11:22592136-22592158 TGGGATCTTAAAGAAAAAGAGGG - Intergenic
1080593752 11:33749030-33749052 TGAGAACTTAGAAAAATAGATGG - Intronic
1081018812 11:37916832-37916854 TGAGAACTTAAATAAAATGAAGG - Intergenic
1081429922 11:42965727-42965749 TGGCAATTTAAAAAAAAGAAGGG + Intergenic
1081984414 11:47291097-47291119 TGCAGACGTAAATAAAAGGAGGG - Intronic
1082198729 11:49336176-49336198 TGGAGACTTAAATAAAAGGAAGG + Intergenic
1082847705 11:57739948-57739970 TGGGTACCTAAAAAAGAGGAAGG + Intronic
1082912611 11:58393842-58393864 TGAGACCTTAATAAAAATGAGGG - Intergenic
1084448803 11:69220431-69220453 CTTCAACTTAAAAAAAAGGAGGG - Intergenic
1084854662 11:71975002-71975024 GGAGAACTTCAAAAATAGGATGG - Intronic
1085089042 11:73693920-73693942 TTCAAAGTTAAAAATAAGGATGG - Intronic
1086657080 11:89371917-89371939 TGGAGACTTAAAAAAAAGGAAGG - Intronic
1086955543 11:92931205-92931227 AGCAAATTTAAAAAAAAGGTTGG - Intergenic
1087156697 11:94911529-94911551 TGTGAACTTAAAATGAATGAAGG + Intergenic
1087612008 11:100446158-100446180 TGCAACCTTCAAAGAAAGGAGGG - Intergenic
1087777064 11:102266466-102266488 TGTGAATTTAAAAAACATGAAGG + Intergenic
1087801909 11:102513627-102513649 TGGGACCTAAAAAAAAAAGATGG - Intergenic
1089062246 11:115634884-115634906 TGAGAATTAAAAAAAAAAGAAGG + Intergenic
1090067214 11:123513380-123513402 TGCAACCTTAAAAAAAAAAAGGG - Intergenic
1090573390 11:128072371-128072393 TGCAAGCTTAAGGAAAAGGAAGG + Intergenic
1092960131 12:13588943-13588965 TTCGTTCTTAAAAAATAGGATGG - Intronic
1093416247 12:18924242-18924264 TGCTTTCTTAAAAAAAAGGAGGG - Intergenic
1094014092 12:25843062-25843084 TCCCATCTTAAAAAAAAGTAAGG - Intergenic
1094534646 12:31310208-31310230 TGTGAACTTAAAGCAAGGGATGG + Intronic
1094568344 12:31620012-31620034 TGGGAAGTTAAAAAAAGGGAAGG - Intergenic
1098111255 12:67124080-67124102 TGCTCCCTTAAAAAAAAGGCTGG + Intergenic
1098823896 12:75269339-75269361 TGCTATGTTAAAAAAAAGGGGGG + Intergenic
1099128782 12:78800111-78800133 TGCTAATTTAAAAAGAGGGAGGG - Intergenic
1099258510 12:80346385-80346407 TAAGAACTAAAAAAAAAGGGAGG + Intronic
1099770599 12:87048748-87048770 TGGGAATTTATATAAAAGGAAGG + Intergenic
1099855554 12:88160879-88160901 TCCAAAGTTAAAAAAAAGAATGG - Intronic
1099920217 12:88948241-88948263 TGCTAACTTTAAAAAATGGAAGG - Intergenic
1100000364 12:89827342-89827364 TGGAAACTTAAAAAAAAAAAAGG + Intergenic
1100830314 12:98511320-98511342 TAAGAACTTCAAAAAAAGAATGG + Intergenic
1100871963 12:98919250-98919272 TACTAAATTAAAAAAGAGGATGG + Intronic
1101274798 12:103187690-103187712 TCCTAAGTTAAAAAAAAGGCTGG + Intergenic
1101596088 12:106165768-106165790 TGGGAAGAAAAAAAAAAGGAGGG + Intergenic
1102137163 12:110584988-110585010 TGTGCCATTAAAAAAAAGGAAGG - Intergenic
1102278821 12:111602086-111602108 TTCAAAATTAAAAAAAAAGAAGG + Intergenic
1103822093 12:123707169-123707191 TAGAAACTTAAAAAAAAGTACGG + Intronic
1103942046 12:124506476-124506498 TGGAAACAAAAAAAAAAGGAGGG - Intronic
1106180864 13:27368250-27368272 TGCCAACTTAAAAAAAAAAATGG + Intergenic
1106738378 13:32611822-32611844 TGGGAAGTTAACAAAAAGGGGGG - Intronic
1106880247 13:34121439-34121461 TGGGAACATAAAATAAGGGAAGG - Intergenic
1107665616 13:42687253-42687275 TGCTAAATTAAAAAAAAAAATGG + Intergenic
1108864508 13:54906217-54906239 TGAGAACTTTTAAAAAGGGAGGG + Intergenic
1109395575 13:61754295-61754317 AGCGAAAGTAAAAAAAAGCAAGG - Intergenic
1109986491 13:69993212-69993234 GGGGAACTTACAAACAAGGATGG + Intronic
1110478278 13:75943750-75943772 TGAGAACATAAACACAAGGAGGG + Intergenic
1111447769 13:88372317-88372339 TCCGAATTTAAAAAAAAACAAGG + Intergenic
1112221059 13:97491014-97491036 TGTGAAATTAAAAAAAAATAGGG - Intergenic
1112685456 13:101819919-101819941 TGTGTAATTAGAAAAAAGGATGG + Intronic
1113020219 13:105876819-105876841 TGAGAAATTCAAAAGAAGGAAGG - Intergenic
1115153882 14:30315999-30316021 TGACAACTTAAAGCAAAGGAAGG - Intergenic
1116367056 14:44080277-44080299 TGTATACTTAAAAAAAAGTAGGG - Intergenic
1117927785 14:60802462-60802484 TGTCAACTGAAAAAAAAAGAGGG + Intronic
1118620252 14:67608523-67608545 TACCACCTTAAACAAAAGGAGGG + Intergenic
1120031701 14:79649103-79649125 TGAAAACTTAAAGAAGAGGAGGG - Intronic
1120146739 14:80987046-80987068 AACAAACTTAAGAAAAAGGAAGG - Intronic
1120400908 14:84030380-84030402 TGCAAAGTTAAAAAAAAAAAGGG - Intergenic
1122065442 14:99170256-99170278 TGCAAAGTTAAAAAAAAGGGGGG - Exonic
1122731812 14:103805562-103805584 TGCTGTCTCAAAAAAAAGGAAGG + Intronic
1124133878 15:27016697-27016719 TGCGAATTTAAAAGGAAGAAAGG - Intronic
1124817878 15:33014733-33014755 TGTGAACTGATCAAAAAGGAAGG - Intronic
1126056730 15:44736719-44736741 TGCTAAGTTAAAAAAAAAAAGGG - Intronic
1126968769 15:54085930-54085952 TGTCAACTAAAATAAAAGGAGGG - Intronic
1131589347 15:93731432-93731454 TGCGAATATAAAAAAAAAAAGGG - Intergenic
1135714870 16:24754555-24754577 TCCATACTTTAAAAAAAGGAGGG + Intronic
1137030266 16:35517423-35517445 TCCAAACAGAAAAAAAAGGAAGG - Intergenic
1137787103 16:51148991-51149013 TGCGAAGAAAAAAGAAAGGAAGG + Intronic
1137920441 16:52482652-52482674 TGAGAAGCTAAAAAAAGGGAGGG + Intronic
1138346334 16:56322522-56322544 TGCCAGCACAAAAAAAAGGATGG - Intronic
1138863548 16:60789409-60789431 TACTAAGTTAAAAAAAAGGAAGG - Intergenic
1139076725 16:63459915-63459937 TATGAACCTAAAAAAAAGGCTGG - Intergenic
1140397743 16:74643278-74643300 TGTGAACTAGAAAAAAAGTAAGG - Intronic
1141536968 16:84688541-84688563 TGCCATCTCAAAAAAAAGAAAGG - Intergenic
1147207677 17:38849783-38849805 TGCAAACTCACAAAAAAGCAAGG + Exonic
1149897904 17:60444451-60444473 TGCGATCTTAGAAATAATGAAGG - Exonic
1150554346 17:66240311-66240333 TGGGAAAGAAAAAAAAAGGATGG + Intronic
1151024661 17:70663714-70663736 TGAGAACTAAATAAAAAGAATGG - Intergenic
1151110142 17:71666744-71666766 TGCAATCTTAAAAAAAAAAATGG + Intergenic
1152982917 18:295897-295919 TGAGATTTTAGAAAAAAGGAAGG + Intergenic
1153775112 18:8446079-8446101 AGCTAACTTAGAAAAAAAGAGGG - Intergenic
1154046421 18:10909809-10909831 GGCCAACTTAAAAGAAAGAATGG - Intronic
1155845708 18:30703493-30703515 TGGGAAAGGAAAAAAAAGGAGGG + Intergenic
1155880254 18:31138556-31138578 TGCCAACATAGAAAAAAGTAGGG + Intronic
1156072927 18:33235569-33235591 TGGAAACTTAGTAAAAAGGAAGG - Intronic
1156173820 18:34518679-34518701 TGCCAAATTAAAAAAAAAAACGG - Intronic
1156187322 18:34678241-34678263 TGAGAACTTAGATAAGAGGAAGG + Intronic
1156619036 18:38826670-38826692 TGGAATATTAAAAAAAAGGAAGG + Intergenic
1158168051 18:54564181-54564203 TGCCATCTAAAAAAAACGGAGGG - Intergenic
1158367864 18:56759755-56759777 TTCAAACTTAAAAAAAAGTAGGG - Intronic
1158543533 18:58377390-58377412 TGTGAAATTAAAAAAAAAGAAGG - Intronic
1158828624 18:61253118-61253140 TGAAAAAATAAAAAAAAGGAAGG + Intergenic
1158840946 18:61386365-61386387 TGAGACCTCAAAAGAAAGGAAGG - Intronic
1159459830 18:68710924-68710946 TCCAAACTTTAAAGAAAGGAAGG + Intronic
1159928026 18:74285935-74285957 TGGGAACCTAAAAACATGGAAGG + Intronic
1162200173 19:9014337-9014359 TGGGAACTCCAAAAAAAGGGAGG + Intergenic
1163540800 19:17908907-17908929 TAAGAACTTAAAAAAAAAAAAGG + Intergenic
1163992920 19:21015996-21016018 TGAGAACTTAACCAAAAGGGGGG + Intergenic
1164758245 19:30707098-30707120 TGATAACTTAAAAAATTGGATGG + Intronic
1168156311 19:54474847-54474869 TGGGAACTTGATAGAAAGGATGG - Intergenic
925513587 2:4654183-4654205 TGCATGCTTAAAAAACAGGAAGG + Intergenic
925780117 2:7374323-7374345 TGAGAACTAAAATAAAAGAATGG - Intergenic
926143570 2:10383367-10383389 TGCGGTCTGAAAAAAAAGGGGGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928085416 2:28343351-28343373 TGTGAAATAAAAAAAGAGGAAGG - Intergenic
928147761 2:28795174-28795196 TGCGACCATAAAATTAAGGAAGG - Intronic
929626021 2:43407854-43407876 TGGGAACATAAAAAGAATGATGG + Intronic
930441447 2:51412532-51412554 TTCAAACTTAAAAAAAGAGAAGG + Intergenic
931129819 2:59322668-59322690 TTAGAAATTAAAAAAAAGTAAGG - Intergenic
931215634 2:60241395-60241417 TGCTAACCTAATCAAAAGGAAGG - Intergenic
932163536 2:69484893-69484915 TAAAAACATAAAAAAAAGGAAGG + Intronic
937615064 2:123912169-123912191 TGGGAACTTTAAAAAAATCACGG + Intergenic
938675595 2:133630589-133630611 TCAGAACTTAAAAAAAAAAATGG + Intergenic
938859268 2:135349943-135349965 TTCGAACTTAAAAGAAGAGAAGG - Intronic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939824157 2:146994508-146994530 TGCCAGCTTAAAAAAAAAAAAGG + Intergenic
940363035 2:152816068-152816090 TGCCAACTGAAAAGAAAGCATGG + Intergenic
941410675 2:165153541-165153563 ACCTAACTAAAAAAAAAGGAGGG + Intronic
941883313 2:170503523-170503545 TGCAAGGCTAAAAAAAAGGAAGG - Intronic
941883320 2:170503582-170503604 TGCAAGGCTAAAAAAAAGGAAGG - Intronic
942502871 2:176610153-176610175 TGGAAACTTAAAAAAAAGGTTGG - Intergenic
943447991 2:188013465-188013487 TCCCATCTTAAAAAAAAGAAAGG - Intergenic
945111460 2:206364363-206364385 ACCTAACTTAAAGAAAAGGAGGG + Intergenic
945567949 2:211427308-211427330 TGCCCACTTAAATAAAAGGGTGG - Intronic
945876487 2:215283265-215283287 CGCCATCTAAAAAAAAAGGAGGG + Intergenic
946231552 2:218294497-218294519 TTCCATCTCAAAAAAAAGGAAGG - Intronic
948103603 2:235394842-235394864 TGTGAGCTTGGAAAAAAGGATGG - Intergenic
948964768 2:241369993-241370015 TGGGAACTGAAAAAAAGTGATGG + Intronic
1169201780 20:3713976-3713998 TGTGAAATTAAAAAAAAAAATGG - Intergenic
1170388699 20:15849111-15849133 TGTGAACATAAAAGAAAGGAAGG - Intronic
1171106386 20:22437203-22437225 TGCCAACTAAAAATAAAAGAGGG - Intergenic
1172030368 20:31977752-31977774 TGCGAACTCAAAGTAAAGGGAGG + Intronic
1173702813 20:45088054-45088076 TGCAAACTTAAAACAAATGCTGG + Intergenic
1174634993 20:51991541-51991563 TGAGAACTTAACAAAAATCATGG - Intergenic
1177192629 21:17868890-17868912 TTAGAAATTAAAAAAAAAGAAGG + Intergenic
1177204642 21:17997103-17997125 TATGAACTTAAAAGAAAGGTGGG - Intronic
1177869375 21:26552356-26552378 AGCTAACTTAAGTAAAAGGATGG - Intronic
1178423347 21:32459487-32459509 GGAGAACAGAAAAAAAAGGAAGG - Intronic
1178936181 21:36863929-36863951 TGTGAACTTAAAAATATGCAGGG - Intronic
1179174636 21:38999615-38999637 AGTGAACTTAAAAAAAATCATGG - Intergenic
1179729860 21:43361690-43361712 TGAGAACTAAAAAATAAGGAGGG - Intergenic
1182182656 22:28366757-28366779 TGCGAACATAAAAAAGACCAGGG + Intronic
949835525 3:8265429-8265451 TGGGAACTTCAAAATAAGGGAGG + Intergenic
950429418 3:12942304-12942326 TTTAAACTTAAAAAAAAGGCCGG + Intronic
951726143 3:25762654-25762676 TAAGAACTTAAAAAAAGGGCTGG + Intronic
952573497 3:34745796-34745818 TGAAAAATTAAAAAGAAGGAAGG + Intergenic
953741658 3:45543856-45543878 TGCTAACTTAAGAAAAAGAGAGG + Intronic
954049868 3:47966064-47966086 TCCCAACTTAAAAAAAAGAGAGG + Intronic
956617686 3:71189517-71189539 TAAGAACTTATAATAAAGGATGG - Intronic
956894505 3:73646039-73646061 TGGGAACTGAAAAGACAGGAAGG - Intergenic
957582721 3:82095508-82095530 TTCAAACTCAAAGAAAAGGATGG - Intergenic
957611648 3:82474228-82474250 TGGGAACTTAAGAAAATGGTAGG + Intergenic
957879776 3:86197236-86197258 TGTGAACTTCAAAAAGAGAAAGG - Intergenic
958017066 3:87950552-87950574 TGTCAACTTAAAAAAAAAAAGGG + Intergenic
959393436 3:105805187-105805209 TGCGAACTTTATAAAAATTAGGG - Intronic
959487597 3:106945263-106945285 TGCAAACTTAAGCCAAAGGAAGG + Intergenic
960658819 3:120035622-120035644 TGAATACCTAAAAAAAAGGATGG - Intronic
962725978 3:138227294-138227316 TGAGAACATAGAGAAAAGGAAGG + Intronic
963472888 3:145765404-145765426 TGATTACTTAAAAGAAAGGATGG + Intergenic
964380073 3:156089420-156089442 TTGGAAGTTAAAAAAAAAGATGG + Intronic
965143988 3:164874192-164874214 TGTGAACTTACAAAAAACCACGG + Intergenic
965361696 3:167748555-167748577 TGCAACATTAAAAATAAGGAAGG + Intronic
965475773 3:169153449-169153471 TCCGAAGTTAAAAAGAATGAGGG - Intronic
965775672 3:172228041-172228063 GGCTCACATAAAAAAAAGGATGG - Intronic
967437966 3:189473043-189473065 ATAGAACTTAAAAGAAAGGAAGG + Intergenic
969341086 4:6541842-6541864 TTCTAACTTTAAAAAAAGGGAGG + Intronic
970469712 4:16365171-16365193 TGTGAATTCAAAAGAAAGGATGG - Intergenic
970658982 4:18263186-18263208 TGCAAACTGTCAAAAAAGGAAGG - Intergenic
970943709 4:21665445-21665467 TGCCAACTTAAAAAGAAGTCAGG + Intronic
974580333 4:63791557-63791579 TGGCAACTTAAAAAATAGGTTGG - Intergenic
975384625 4:73741713-73741735 AGCAAACTTAAAATTAAGGAAGG + Intronic
975473875 4:74799465-74799487 TGTCACCTTAAAACAAAGGAAGG - Intergenic
975576679 4:75869944-75869966 GGAGAACTTAGAAAAAAGGAGGG - Intronic
975794343 4:77990499-77990521 TGCAATCTTAGTAAAAAGGAAGG - Intergenic
976128427 4:81857957-81857979 TGGGAACTCAAAATAAAGGTGGG - Intronic
976324513 4:83755625-83755647 TTAGAACTGAAAGAAAAGGATGG - Intergenic
977263434 4:94825541-94825563 TCCCATCTTAAAAAAAAAGATGG - Intronic
977684260 4:99829967-99829989 TGCAAAATTACAAAAAAGAAAGG - Intronic
978898550 4:113921170-113921192 TTCAAACTTAAATAAAAGTATGG + Intronic
979062971 4:116089791-116089813 TGGGAAGTGAAAAAAAATGATGG + Intergenic
979343240 4:119553776-119553798 TGTGCAGTTAAAAAAAAGCATGG + Intronic
980055674 4:128077196-128077218 TGCCCATTTAAAAAAATGGAAGG + Intronic
980553286 4:134368697-134368719 TGGGAATTTAATAATAAGGAAGG - Intergenic
981950714 4:150403573-150403595 TTTGAAGTTAAAAAAAAGAAGGG - Intronic
982440736 4:155432900-155432922 TGCCAACTGAAAACAAAGGAGGG + Intergenic
983019831 4:162661923-162661945 TGAGAACTTGATCAAAAGGAGGG - Intergenic
983292637 4:165825594-165825616 TGCTAAATTGACAAAAAGGAAGG - Intergenic
984451262 4:179905894-179905916 TTTGATCTTTAAAAAAAGGAAGG + Intergenic
984466807 4:180110220-180110242 TGAGAACTTCACAAAAAGAAAGG + Intergenic
985516575 5:348328-348350 TGCAAAAAAAAAAAAAAGGAGGG - Intronic
986201435 5:5582643-5582665 TGAGAAATAAAAAAAAAGTAAGG - Intergenic
986451186 5:7867650-7867672 TGTGAAGTGGAAAAAAAGGATGG - Exonic
987051629 5:14151728-14151750 TGTGAACTTGAAAAAGTGGATGG - Intronic
988118812 5:26933474-26933496 GGCTAACTAAAAAAAAAAGAAGG + Intronic
988441285 5:31236635-31236657 TGGGGATTTAAAAAAAAGGAGGG + Intronic
988497310 5:31756413-31756435 TGAGTAATTAAATAAAAGGAAGG + Intronic
990802913 5:59625496-59625518 TGCGACATTAAAAAAAAAAAAGG + Intronic
990978621 5:61581233-61581255 AGCAAACCTAAAAAAAAGTAGGG + Intergenic
992913246 5:81420099-81420121 TGTAAACGTGAAAAAAAGGATGG + Exonic
993236858 5:85322012-85322034 TGTGGAATTAAAAAAAAAGAAGG + Intergenic
994202406 5:96992761-96992783 TGCTAGCTTAAAAAAAAGCGGGG + Intronic
994401176 5:99281506-99281528 TTTCAACTTAGAAAAAAGGATGG - Intergenic
994735278 5:103546369-103546391 TGGGAACTAAAAAAAAAGATTGG + Intergenic
995984170 5:118148159-118148181 TGCAAACTGAAAAAAAAATAGGG - Intergenic
996389952 5:122949054-122949076 GGCTAACTTAAAAACAAGAAAGG + Intronic
997044936 5:130304044-130304066 TTCTAAATTAAAAAAAAAGATGG + Intergenic
997155758 5:131554910-131554932 AAAGAACTTAAAATAAAGGAGGG + Intronic
998467916 5:142360620-142360642 AGGGAAATTAAAACAAAGGAGGG - Intergenic
1000000593 5:157135087-157135109 TGCAAACTTAAAAAAAATGAGGG - Intronic
1000287550 5:159839724-159839746 GCCGAAGTTAAAAAAAAAGAAGG - Intergenic
1001417716 5:171558616-171558638 TGCTGACTTCAGAAAAAGGAAGG - Intergenic
1001879713 5:175232961-175232983 TGAGCACTTAAAAAAAAGAATGG + Intergenic
1002347203 5:178556281-178556303 TGCGTTATTAAAAAAAAAGAAGG + Intronic
1003270832 6:4606427-4606449 GGAGAACTTACAAAAAAGGGAGG + Intergenic
1003391826 6:5720197-5720219 TAGGCACTTAAGAAAAAGGAAGG + Intronic
1004039621 6:11962606-11962628 TACTCACTTAAAAAAAATGAGGG - Intergenic
1004333687 6:14744500-14744522 TGAGGACTTTAAAAAAAAGAAGG + Intergenic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1006520680 6:34569216-34569238 TGGGAACTGTAAAAATAGGAGGG + Intergenic
1008219704 6:48840954-48840976 TGAGAAATTAAAACAAAGGAAGG - Intergenic
1009247550 6:61258226-61258248 TGGGAAATTAAAAAAGAGAAGGG - Intergenic
1009419828 6:63453584-63453606 TGCAAACAAAAAAAAAAGCAGGG - Intergenic
1010450301 6:75994837-75994859 TGTGAGCTAACAAAAAAGGATGG + Intronic
1011076171 6:83441641-83441663 TGCGAAAAAAAATAAAAGGATGG - Intergenic
1011952145 6:92979787-92979809 TGCTAACTTCAAAAATAGAAGGG - Intergenic
1012304077 6:97628754-97628776 TGCAAACTTAAAAAAATATATGG - Intergenic
1012628348 6:101431564-101431586 TGGCAAGTGAAAAAAAAGGAAGG + Intronic
1012995639 6:105970505-105970527 TGCGTACTTAAAATAATTGAAGG - Intergenic
1016716695 6:147240696-147240718 TGTGAACTTAAAGTAGAGGAAGG + Intronic
1017428447 6:154346430-154346452 TGCCAATTTAGAAAAAAGGAGGG - Intronic
1017739566 6:157394892-157394914 TGAGAATTTTAAAAAAATGATGG + Intronic
1019328224 7:450013-450035 TGCAATTTTTAAAAAAAGGAAGG + Intergenic
1020683518 7:11265909-11265931 TGTGGAAGTAAAAAAAAGGAGGG + Intergenic
1021355316 7:19647699-19647721 TGCTTACTTTAAAAAAAGAAAGG + Intergenic
1021962349 7:25885405-25885427 TGGGAAGGAAAAAAAAAGGAGGG - Intergenic
1022513920 7:30963629-30963651 TGGGATCTTAAAGAATAGGAAGG - Intronic
1024169562 7:46769717-46769739 TGTGACCTTATAAATAAGGAAGG - Intergenic
1025223937 7:57140349-57140371 TGCAAACTCAAATAAAAGTAAGG + Intergenic
1025864665 7:65369935-65369957 TGAGAACTTAACCAAATGGAGGG + Intergenic
1026067084 7:67084252-67084274 TCCTTATTTAAAAAAAAGGAGGG + Intronic
1026080299 7:67212259-67212281 TGCTAAGTTAAAAAAAAAAAAGG - Intronic
1026709846 7:72728085-72728107 TCCTTATTTAAAAAAAAGGAGGG - Intronic
1027984256 7:85265963-85265985 TGAGAACTAAAAAAAATAGATGG - Intergenic
1029423904 7:100485188-100485210 TGAGAACGGAAAAAAAAGAAAGG - Intronic
1030227754 7:107170745-107170767 TGAGAAGTTAAGAAAGAGGAAGG - Intronic
1034286158 7:149884586-149884608 TGTCAACTTAAAAAAAAAAAAGG + Intergenic
1034325461 7:150226991-150227013 TGCTAATTTAAATAAAAGCAAGG - Intergenic
1035361612 7:158317208-158317230 TGTGAAATTACATAAAAGGAGGG - Intronic
1035988257 8:4458295-4458317 TGCGCACACAAAAAAAAAGAGGG - Intronic
1036797153 8:11764555-11764577 TGCCTCCTTAAAAAAAAGGAGGG + Intergenic
1037136502 8:15468934-15468956 TGCTGACTTAAAAATAATGAGGG + Intronic
1038013842 8:23496849-23496871 TGTTAAAATAAAAAAAAGGAGGG + Intergenic
1038082457 8:24154462-24154484 TGCAAATTTAAAAAATAAGATGG + Intergenic
1039124130 8:34181848-34181870 TGTCAAAATAAAAAAAAGGAGGG + Intergenic
1039222566 8:35350689-35350711 TTGAGACTTAAAAAAAAGGATGG - Intronic
1041357541 8:57015971-57015993 TGAGAAATTAAAAAAAAAAAGGG - Intergenic
1043824846 8:84913822-84913844 TACTGATTTAAAAAAAAGGAGGG + Intronic
1044362891 8:91309456-91309478 TGCTAACTTAAACAAATGGATGG - Intronic
1044482007 8:92701812-92701834 AGTGAATTTAAAAAGAAGGAAGG - Intergenic
1045055028 8:98361577-98361599 TATGATCTTAACAAAAAGGATGG + Intergenic
1045347445 8:101305755-101305777 TGCGAAGTTAAAAAAAAGGTTGG - Intergenic
1046312460 8:112455859-112455881 TGGGATTTAAAAAAAAAGGAAGG + Intronic
1048567754 8:135621119-135621141 TGCAGCCTTAAAAAAAAGGGGGG + Intronic
1049812963 8:144584006-144584028 TGCAAACTTAATGACAAGGAAGG + Intronic
1052095617 9:24380495-24380517 TTCAAACTTAAAACAAAGGTTGG - Intergenic
1055800238 9:80027262-80027284 TACGCACTTGAAAAAAGGGATGG - Intergenic
1055805518 9:80088752-80088774 TGCAAACATAAAAAAAAGACAGG - Intergenic
1055883414 9:81030795-81030817 TGCTAATTTAAAAGATAGGAGGG - Intergenic
1057122335 9:92587462-92587484 TGCCATCTCAAAAAAAAGGGGGG + Intronic
1057736787 9:97669927-97669949 TGCCATCTCAAAAAAAAGGTGGG - Intronic
1058200972 9:102040081-102040103 TGGGGACTTCAAAACAAGGAAGG - Intergenic
1058232043 9:102437606-102437628 TGACAACTCAAAAAAAAGGGGGG - Intergenic
1058589842 9:106552329-106552351 AATGAAGTTAAAAAAAAGGAAGG + Intergenic
1059542567 9:115144556-115144578 TGGGAATTTAAAAAGAAAGAAGG - Intronic
1062336166 9:136069651-136069673 TGCAAACATAAAAGAAAGCAAGG + Intronic
1186677571 X:11835047-11835069 TGGGAAGTCACAAAAAAGGAAGG + Intergenic
1188683399 X:33040157-33040179 TGGGAACTTGCAAAAAAGTAAGG + Intronic
1189071604 X:37869562-37869584 TGGGAATGTAAAAATAAGGATGG + Intronic
1190648351 X:52544138-52544160 TGCGAACGAAAGAAGAAGGAGGG + Intergenic
1191643838 X:63457146-63457168 TGAGAACTTGACAAAAAGGGAGG - Intergenic
1192610881 X:72565844-72565866 TTTGAATTTAAAAAAAAGGCAGG + Intronic
1193136832 X:77981060-77981082 TGCTAATTTAAAAAAAAGCAAGG - Intronic
1194442363 X:93948327-93948349 TGTGAACTTAAAATAAAAGTTGG + Intergenic
1194555733 X:95356457-95356479 TGCGGACTGAAAATAGAGGAAGG - Intergenic
1195151926 X:102080517-102080539 TGGAAAATTAAAAAAAAAGAGGG + Intergenic
1196141848 X:112271551-112271573 TGAGCAATTAAAAAAAAAGAAGG + Intergenic
1196949181 X:120858783-120858805 TGAGCAATTAAAAAAAAGGTGGG - Intergenic
1197736910 X:129857469-129857491 TGCAAAACAAAAAAAAAGGAGGG - Intergenic
1198193854 X:134340071-134340093 TGCTGACTGAAAAAAAATGACGG - Intergenic
1200020662 X:153203758-153203780 TACGTACTGAAAACAAAGGAGGG - Intergenic
1200917468 Y:8583958-8583980 TGGGAAATTCAAAAAAATGAAGG - Intergenic