ID: 923607157

View in Genome Browser
Species Human (GRCh38)
Location 1:235454383-235454405
Sequence CTCCTTTATCATCACTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923607155_923607157 -2 Left 923607155 1:235454362-235454384 CCTGCCACTATTAAAACTTGACT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 161
923607154_923607157 23 Left 923607154 1:235454337-235454359 CCTCTTGTGTTAGTCTGACACAT 0: 1
1: 0
2: 0
3: 11
4: 658
Right 923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 161
923607156_923607157 -6 Left 923607156 1:235454366-235454388 CCACTATTAAAACTTGACTCCTT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923607157 Original CRISPR CTCCTTTATCATCACTACAA AGG Intronic
900733921 1:4282804-4282826 CTGCTCTATCATCATTACTATGG - Intergenic
901077962 1:6567250-6567272 CTCCTTTTTAATCAATACCAGGG - Intronic
902665538 1:17935149-17935171 CACCTTTCTCATCACTAAAGTGG - Intergenic
902691567 1:18113103-18113125 CTGCTTTTTCATCACTGGAAAGG + Intronic
903234189 1:21938820-21938842 CTCCTCTATCATTACTCAAAAGG - Intergenic
906484848 1:46226303-46226325 CTCCTGTACCATCACCACCAGGG + Intergenic
908162598 1:61425574-61425596 CTTCTTTATCATCACCTCCAAGG - Intronic
908196265 1:61748603-61748625 CTCCCTTATACTCACTACAGTGG + Intronic
909575051 1:77165497-77165519 CTGCTTTATCATCAGTTGAATGG + Intronic
910442522 1:87267289-87267311 CTCCTTTATCATTTTTACAGAGG - Intergenic
917008850 1:170448000-170448022 CTCCTTTCTCATCCCTTCACAGG + Intergenic
917569018 1:176244544-176244566 TTCCTTTTTCATCCCTACACAGG - Intergenic
919209469 1:194461224-194461246 TTACTTTATCATCAATAAAAAGG - Intergenic
919528923 1:198691394-198691416 CTCCTTTATTCTCACTTGAAAGG + Intronic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
1064181642 10:13121598-13121620 CACCTTTGTCATCACTTCAGAGG + Intronic
1066543715 10:36476466-36476488 CTCCATTATCATTTCTACTATGG - Intergenic
1067988822 10:51185180-51185202 CTCTTTTATCATCTGTAAAATGG + Intronic
1068620028 10:59172316-59172338 CTCCTATAAGAGCACTACAAAGG - Intergenic
1072752405 10:97991650-97991672 CTCATTTGTCTTCACCACAATGG + Intronic
1075301901 10:121332434-121332456 CTCCTTCATCATCACCATCATGG - Intergenic
1076031141 10:127159787-127159809 CTCCTTTATCATTCCTGCAGTGG - Intronic
1078306154 11:10188626-10188648 CTCCTCCATACTCACTACAATGG - Intronic
1080046426 11:27813196-27813218 TTCCTTGGTCATCACCACAAAGG - Intergenic
1081042500 11:38228704-38228726 TTCATTTTTCATCACTACAATGG - Intergenic
1081408527 11:42726895-42726917 CACCTTTCTCATCATTAAAATGG - Intergenic
1082052805 11:47786460-47786482 CTCATCTGTCATCACTACTAAGG - Exonic
1082778940 11:57271190-57271212 TACCTTCATCATCACTAAAATGG - Intergenic
1085860123 11:80223207-80223229 CACCTTCATCATCAATAAAATGG - Intergenic
1086626061 11:88954776-88954798 CTACTTTATCATGCCAACAATGG - Intronic
1086670853 11:89545767-89545789 CTGCTTTTTCATCATGACAATGG - Intergenic
1087415075 11:97844541-97844563 CTCCTTTATCATGAAGAAAATGG - Intergenic
1088114871 11:106302642-106302664 CTCCATCATCATCACTCCAGGGG - Intergenic
1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG + Exonic
1092995219 12:13943225-13943247 CTCCTTTTTCATCCTTAAAATGG - Intronic
1094203231 12:27814369-27814391 CTCCTTTTTCATGACTAAATAGG + Intergenic
1096305922 12:50475504-50475526 TTTTTTTATCATCACTTCAAAGG + Exonic
1099420496 12:82452884-82452906 CTTCTTGATCATCAGTAGAATGG - Intronic
1099934150 12:89105560-89105582 CCCCTTTATCATAATTGCAAGGG + Intergenic
1100773894 12:97953715-97953737 CTCCTTTATCATACTTGCAATGG + Intergenic
1102835072 12:116048939-116048961 CTGCATAATCATGACTACAAAGG + Intronic
1103631063 12:122261434-122261456 CTCGTCTATCTTCACTGCAAAGG + Exonic
1105699439 13:22925434-22925456 CACCTTTATCATCGCTAGAAAGG - Intergenic
1105741931 13:23335169-23335191 CTCCATTATCATCACGCCACAGG + Exonic
1108837512 13:54570441-54570463 CTCTTTTCTCAACACTTCAATGG - Intergenic
1110142328 13:72145891-72145913 CTCCATTATCTTCACCTCAAAGG - Intergenic
1110392093 13:74985683-74985705 CACCATTATCATGACAACAATGG + Intergenic
1111235457 13:85402250-85402272 CCCATTTATCCTCCCTACAAAGG + Intergenic
1111314279 13:86532301-86532323 CTCCTTTACCATCAGGACCACGG - Intergenic
1111852915 13:93599652-93599674 ATTCTTTATCTTCACTACATGGG - Intronic
1113477024 13:110591126-110591148 CTCCTTTCTCAGGACTCCAATGG + Intergenic
1116231484 14:42223590-42223612 CTCCTTGATCATCTCTCCAAAGG - Intergenic
1128263682 15:66250962-66250984 CTCCTTTCTCATCATTCCCAGGG - Intronic
1129669463 15:77599099-77599121 CTACTTTCTCATCTGTACAATGG + Intergenic
1139003547 16:62543126-62543148 CTCTTTTATCATTATTTCAAAGG + Intergenic
1139734652 16:68977117-68977139 CTCCTTCATCAGCACTTCAGAGG + Intronic
1141640496 16:85338192-85338214 CTCCTTTCTCATCTCTGCACCGG + Intergenic
1153784082 18:8518783-8518805 CACCTTTATCATCACAAGAGAGG + Intergenic
1155825875 18:30441965-30441987 CTCATTTACAATCTCTACAAAGG - Intergenic
1156015464 18:32542307-32542329 CTCGTATATCATGACAACAATGG + Intergenic
1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG + Intronic
1158821558 18:61165141-61165163 CTACTTTATCATCCCTCCCAGGG + Intergenic
1159498085 18:69231763-69231785 CAGCATTATCATAACTACAAAGG - Intergenic
1159953198 18:74500462-74500484 CTTATTTATCATCCCGACAATGG - Intronic
1160442582 18:78903709-78903731 CTCTTTTAACATCACAACACTGG + Intergenic
926305769 2:11636661-11636683 CTCCTTTAACATCACTTCCCTGG - Intronic
926803620 2:16684444-16684466 CATCTTTCTCCTCACTACAATGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930384410 2:50675534-50675556 CTAGTTTATCATCACTCCACTGG - Intronic
932067565 2:68582499-68582521 CTTCTTAATCATGACTGCAAGGG + Intronic
933364422 2:81332176-81332198 CTGCCATATCATCACTACCATGG + Intergenic
933676848 2:85064807-85064829 CACTTTTATCATCAGTAAAATGG - Intergenic
937050589 2:118885231-118885253 CTCCATTATCTTCTCTACAAAGG - Intergenic
937174384 2:119913362-119913384 CTACTTTATACTCACTAGAATGG - Intronic
937498121 2:122447275-122447297 CTCCTTTATAGAAACTACAAAGG - Intergenic
941091304 2:161179632-161179654 GTCCTGTAGCATCACTATAAAGG - Exonic
941719913 2:168801828-168801850 CTCATTTTTCATCACTCAAAAGG - Intronic
942371417 2:175289939-175289961 CAACTTTATCATCTCCACAATGG + Intergenic
943747452 2:191477262-191477284 CTCCTGTATCAACAATACATAGG - Intergenic
943879730 2:193126139-193126161 CTCCTTTATTTTCAGCACAAAGG + Intergenic
945113065 2:206382629-206382651 CACCTTTATCATGATTTCAATGG - Intergenic
945940787 2:215947663-215947685 CTACTTTATTCTGACTACAAAGG - Intronic
946220834 2:218225153-218225175 CTCCCCTATCATCAATAAAATGG - Intronic
946609225 2:221440024-221440046 ATCCTTTATGAGCTCTACAAGGG + Intronic
947259723 2:228207348-228207370 ATGATTTATCATCAATACAATGG + Intergenic
1169001090 20:2168554-2168576 CTCCTGGATCATCTCTAAAAGGG + Intronic
1169696298 20:8390596-8390618 TTTCTTTATAATCAATACAATGG + Intronic
1173114704 20:40230203-40230225 CTTCTTTATCAGCACCAAAATGG - Intergenic
1173323585 20:42011741-42011763 CTCCATCATCATCATTACTATGG + Intergenic
1178685822 21:34709939-34709961 CTCCTCTGTCATCCCTAGAAGGG - Intronic
1182289328 22:29266377-29266399 CTCCTTTCTCATCTGTAAAATGG + Intronic
1183522550 22:38303794-38303816 CTGTTTTCTCATCTCTACAAGGG - Intronic
1184908099 22:47505527-47505549 CACTTATATCATCCCTACAAAGG + Intergenic
1185273476 22:49939150-49939172 CTCCTGTATCACCACCACAGTGG - Intergenic
949283448 3:2373341-2373363 CTCTTTTCTCATCCCTAAAAGGG + Intronic
949436273 3:4032914-4032936 CTCTTTTATCATCTGTAAAATGG + Intronic
950722726 3:14896024-14896046 CCCATTTATCATAGCTACAAAGG + Intronic
952839411 3:37631504-37631526 CTCATTTATAATCATTGCAATGG - Intronic
957064797 3:75512893-75512915 GTCCTTGATCATCACTTCAGGGG + Intergenic
957791618 3:84949197-84949219 AGCCTTCATCATCACTACCATGG - Intergenic
958001071 3:87749731-87749753 CAACTTTATTATCAATACAAAGG - Intergenic
959464897 3:106673521-106673543 CTCCATTATCACCATTACCATGG + Intergenic
961633784 3:128320336-128320358 CTATTTTATCATCAATAAAATGG - Intronic
961697094 3:128712875-128712897 CTCCATTTGCATCACTATAAAGG + Intergenic
962222794 3:133577912-133577934 CTCCTTTATAACCACCTCAATGG - Intronic
962911642 3:139856373-139856395 CTGCTTCCTCATCACTAAAATGG - Intergenic
965781561 3:172291664-172291686 CCCTTTTATCACCATTACAAAGG + Intronic
966370595 3:179247555-179247577 CTCGGTTCTCATAACTACAAGGG - Intronic
970809495 4:20075459-20075481 CTCTCCTATCATCACTACACTGG + Intergenic
971046589 4:22811724-22811746 CTCATTTCTCATGAATACAATGG - Intergenic
971267748 4:25109816-25109838 CTCCTTTTTCATCTGTAAAATGG + Intergenic
981349410 4:143711652-143711674 CTTCTTTATCATCCCTACTATGG - Intergenic
982143095 4:152348773-152348795 ATACTTTATCATGACTAGAAGGG + Intronic
982799532 4:159687000-159687022 CTCCTTTACCATCAAAACTATGG - Intergenic
983194377 4:164789337-164789359 CTCCTTTATCTACACTCCATAGG + Intergenic
984565826 4:181329058-181329080 CTGCTTTTTCATCTCTAAAATGG - Intergenic
985202885 4:187502575-187502597 CTCATTTATCATCCCTAAAAGGG + Intergenic
986231038 5:5864948-5864970 CTCCCATATCATAGCTACAAAGG + Intergenic
987194466 5:15511677-15511699 CTCATTTATCATCACAGGAATGG + Intronic
999323229 5:150627273-150627295 CTGCTGTCTCTTCACTACAATGG - Intronic
999597574 5:153222232-153222254 CACTTTTATCACCACTATAAAGG + Intergenic
1001338306 5:170820096-170820118 ATCCTATTTCATCTCTACAAAGG + Intergenic
1008435344 6:51469268-51469290 CACCTTTTTCGTCACTACCAAGG + Intergenic
1008970858 6:57366398-57366420 CTCCATTATCCCCACTACACAGG - Intronic
1009159820 6:60268200-60268222 CTCCATTATCCCCACTACACAGG - Intergenic
1009946419 6:70346870-70346892 CTCCCTGCTCATCACTACCAGGG - Intergenic
1011320485 6:86086800-86086822 CTCCTTTATCAAATCTTCAATGG - Intergenic
1012548494 6:100447611-100447633 CCCCTGTATCATCCCTAGAAGGG - Intronic
1013321932 6:109001295-109001317 CTACATTATCGTCACTACATTGG - Exonic
1013970551 6:116013087-116013109 CTCATTTATGATGACTATAAAGG - Intronic
1014809586 6:125870598-125870620 CTTCAGTATCACCACTACAAGGG + Intronic
1015433549 6:133158950-133158972 TTCCTTTCTCACCAGTACAATGG + Intergenic
1016157418 6:140828880-140828902 CTCCTCAATCATCATTCCAAAGG - Intergenic
1016549132 6:145257496-145257518 CTCCCTTATGATCCCTACCAAGG + Intergenic
1019831774 7:3337390-3337412 CTCTTTTATCATCACTCCAGAGG - Intronic
1020642425 7:10772315-10772337 ATCTTATATCATCACTAGAAGGG + Intergenic
1021279813 7:18703860-18703882 CTCCTTTTTCACCACAACACAGG + Intronic
1022246664 7:28566882-28566904 CTCCTTCATCAACACTTTAAAGG - Intronic
1024724644 7:52178490-52178512 CTCCTTTGCCATCTCTAGAATGG - Intergenic
1026711907 7:72749226-72749248 CTCCCTTATCATCTTTTCAATGG + Intronic
1029884434 7:103851918-103851940 CTCTGTTATCATCAAGACAAAGG - Intronic
1030288525 7:107849469-107849491 CTACTTTATCAAAACTTCAAAGG + Intergenic
1033503420 7:141976618-141976640 CCACTTTCTCATCAGTACAATGG - Intronic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1038363934 8:26911780-26911802 CTCCTTTCTCATCTTTAAAAAGG - Intergenic
1039249807 8:35650403-35650425 CTCCTTAATGATCACTACTGTGG + Intronic
1041403918 8:57474989-57475011 CACCTTTAACATCATTACATTGG + Intergenic
1041582755 8:59481690-59481712 GTCCTGTATCATCATTTCAATGG - Intergenic
1042694807 8:71545171-71545193 CTGCTTTTTCATCAGTACAATGG + Intronic
1043263454 8:78231204-78231226 CACCTTTACCAGCACTTCAAGGG + Intergenic
1043335309 8:79168973-79168995 GTCCATTATCATCATGACAATGG + Intergenic
1045805933 8:106161768-106161790 CTCCTCTATCATCACTTTACTGG - Intergenic
1046225852 8:111279757-111279779 CTGCTTAATCAACACTACAGGGG - Intergenic
1048495571 8:134933005-134933027 CTTCATCATCATCACTAGAATGG - Intergenic
1048502957 8:134995292-134995314 CTGCTTTTTAATCTCTACAATGG + Intergenic
1049248023 8:141573007-141573029 CTCCATCATAATCACTCCAATGG - Intergenic
1049379667 8:142305663-142305685 CTCCTTTATTCTCCCCACAAAGG + Intronic
1050757020 9:9017127-9017149 ATCATTTATCATCGCAACAAAGG - Intronic
1053391989 9:37742419-37742441 CTCTTTTCTCAGCACTACACTGG - Intronic
1056136948 9:83639838-83639860 CACCTTTGTCATTACTTCAAAGG - Intronic
1057667605 9:97058013-97058035 GTCCTTTCTCATCATTAAAATGG - Intergenic
1058117063 9:101096320-101096342 CTCCTTGATCATCTCTAGCATGG + Intronic
1058603940 9:106700864-106700886 CTTCTCTCTCATCTCTACAATGG + Intergenic
1058885342 9:109318763-109318785 CTCCTTTTCCATCAATAAAAAGG + Intronic
1185834289 X:3330544-3330566 CTCCTTAATGATCAATAAAACGG - Intronic
1188664111 X:32797447-32797469 CTCATTTACCATCATTAGAATGG + Intronic
1192601062 X:72464622-72464644 CTCCTTTAACATGACTCCAGTGG - Exonic
1197119753 X:122876396-122876418 CTGCTTTCTCATCTCTAAAATGG - Intergenic
1199071344 X:143478897-143478919 GTACCTTTTCATCACTACAAAGG + Intergenic
1201260745 Y:12156858-12156880 CTCCCTCATCATGCCTACAAAGG - Intergenic