ID: 923608149

View in Genome Browser
Species Human (GRCh38)
Location 1:235464093-235464115
Sequence TAGCACTTATACGTAGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923608149_923608152 11 Left 923608149 1:235464093-235464115 CCAAGACCTACGTATAAGTGCTA 0: 1
1: 0
2: 1
3: 10
4: 46
Right 923608152 1:235464127-235464149 CTCTTGGAACTGTAAAACAAAGG 0: 1
1: 0
2: 0
3: 10
4: 234
923608149_923608151 -5 Left 923608149 1:235464093-235464115 CCAAGACCTACGTATAAGTGCTA 0: 1
1: 0
2: 1
3: 10
4: 46
Right 923608151 1:235464111-235464133 TGCTAAAACTATAAAACTCTTGG 0: 1
1: 16
2: 64
3: 120
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923608149 Original CRISPR TAGCACTTATACGTAGGTCT TGG (reversed) Intronic
900152998 1:1187979-1188001 TAGCTCTTATATTTAGGTCTTGG + Intronic
902673374 1:17991712-17991734 ATGCTCTTATACGTAGTTCTTGG + Intergenic
903409089 1:23125165-23125187 TAGGACTCATGCGTAGGACTAGG - Intronic
904580526 1:31540353-31540375 TAGCTCTTACATTTAGGTCTTGG + Intergenic
908073260 1:60487067-60487089 TAGCTCATATATTTAGGTCTAGG - Intergenic
909507804 1:76413954-76413976 TAGGGCTTATAGGTATGTCTGGG - Intronic
912394209 1:109327698-109327720 TAGTACTTTTACCTAGGTCTGGG - Intronic
916003724 1:160640198-160640220 TAGCACCTGTTTGTAGGTCTTGG - Intronic
923608149 1:235464093-235464115 TAGCACTTATACGTAGGTCTTGG - Intronic
1063252436 10:4287952-4287974 TAGCAATTATGGGTAGCTCTGGG - Intergenic
1070553874 10:77513455-77513477 TAGCACTTATTCCAAGGCCTTGG + Intronic
1072557912 10:96538393-96538415 TAGCTCTTAAATTTAGGTCTAGG - Intronic
1082828619 11:57598798-57598820 TAGCAAACATACGTGGGTCTGGG + Intronic
1083271270 11:61573898-61573920 TTGCAGTTAGAAGTAGGTCTGGG - Intronic
1089333409 11:117705936-117705958 TAGCACTTATTAGTAGGACTTGG + Intronic
1094195904 12:27749907-27749929 TAGGATTTAAACTTAGGTCTGGG + Intronic
1108594103 13:51935712-51935734 TCGCACTCACACCTAGGTCTGGG + Intronic
1112607781 13:100924351-100924373 TATAACATATACGTAGCTCTGGG + Intergenic
1121239333 14:92416929-92416951 AAGCACTTATATGTAAGACTTGG + Intronic
1141418504 16:83896206-83896228 TAGCTCTTACATTTAGGTCTTGG + Intergenic
1159809989 18:73006625-73006647 TAGAACATATAGGTATGTCTAGG + Intergenic
1159937574 18:74381433-74381455 TATCACTTATACGAAGGGATGGG + Intergenic
928295790 2:30082347-30082369 TAGAACTGATACGTAGCTCTAGG + Intergenic
931943331 2:67277451-67277473 TAGCACTGATACTTTGCTCTGGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937681780 2:124652102-124652124 TGGCACTTATCAGTAGTTCTGGG - Intronic
941016469 2:160363172-160363194 TAGCACTTTTAGGTAACTCTGGG + Intronic
1170128472 20:12991771-12991793 AAGCACTTATACTTGGGTATTGG - Intergenic
1173787692 20:45806581-45806603 TTGCACTTATACGTAAGGCTTGG + Intronic
1179009393 21:37544360-37544382 TAGCACTTATATTTAGGCCAAGG - Intergenic
1179218483 21:39386787-39386809 TAACACTTATACGTGGGTCTTGG + Intronic
1184448220 22:44566644-44566666 TAGCTTTTACACTTAGGTCTAGG - Intergenic
957282291 3:78169250-78169272 AAGCACTTTTCCGTAGATCTAGG + Intergenic
960019455 3:112932702-112932724 TGGAACTGATATGTAGGTCTGGG - Intronic
968724601 4:2239413-2239435 TAGCACTTCTACGTAATTATTGG + Intronic
973136495 4:46714269-46714291 AAGCACTTTGACATAGGTCTTGG - Intergenic
976050376 4:81005070-81005092 AAGCACTTATACATAAGTTTTGG - Intergenic
980690168 4:136285652-136285674 TATACCTTATACTTAGGTCTGGG - Intergenic
994608480 5:102003738-102003760 GAGCACTTATACGTAAGACTTGG + Intergenic
995636228 5:114194812-114194834 TAGCTCTTACATTTAGGTCTAGG + Intergenic
1005317782 6:24620906-24620928 TAGCACCTATGCGTATGCCTAGG + Intronic
1005749248 6:28867925-28867947 AAGCACTTATAGGAAGGTCTAGG - Intergenic
1008431303 6:51420869-51420891 TAGCAATTATAGGTAGCTCTGGG - Intergenic
1010130475 6:72486774-72486796 TAGCATTTATACGTAGGAGAGGG + Intergenic
1012964037 6:105653853-105653875 TAGCACTTACATTTAGGTCTTGG + Intergenic
1015314401 6:131801929-131801951 TAGCCCTTATATTTGGGTCTAGG - Intergenic
1015734797 6:136387478-136387500 TAGCGCATAGACGTAGATCTGGG - Intronic
1022325544 7:29327716-29327738 TAGCATTTATACGGCGCTCTAGG - Intronic
1022469536 7:30673870-30673892 TAGCACTTCTACGTCAGTCTGGG - Intronic
1031574453 7:123398645-123398667 TACAAATTATACGTAGGACTTGG - Intergenic
1036491779 8:9233309-9233331 TAGCACTGATATGTGGCTCTTGG - Intergenic
1038927599 8:32157766-32157788 TAGCAATTATAAGTTTGTCTTGG - Intronic
1043451704 8:80374421-80374443 TAGCTTTTATATTTAGGTCTAGG - Intergenic
1050415906 9:5417390-5417412 TAGCTCTTAAATTTAGGTCTTGG - Intronic
1057343603 9:94226517-94226539 TAGCTCTTATGTGTAGATCTTGG + Intergenic
1057534931 9:95892156-95892178 TTTCACTTAAACATAGGTCTTGG + Intronic
1057804546 9:98210965-98210987 TTTCCCTTATACGAAGGTCTGGG - Intronic
1196164774 X:112526715-112526737 TAGAACTCATAGCTAGGTCTTGG - Intergenic