ID: 923611795

View in Genome Browser
Species Human (GRCh38)
Location 1:235502582-235502604
Sequence AACTACTGGATGGCAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923611788_923611795 28 Left 923611788 1:235502531-235502553 CCTGTTCCTTTCTATGGTCTACT 0: 1
1: 0
2: 2
3: 13
4: 178
Right 923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 159
923611787_923611795 29 Left 923611787 1:235502530-235502552 CCCTGTTCCTTTCTATGGTCTAC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 159
923611791_923611795 -4 Left 923611791 1:235502563-235502585 CCTTAATCTAGCCTGGTCTAACT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 159
923611789_923611795 22 Left 923611789 1:235502537-235502559 CCTTTCTATGGTCTACTTCTTCA 0: 1
1: 0
2: 2
3: 23
4: 338
Right 923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923611795 Original CRISPR AACTACTGGATGGCAGATAA AGG Intronic
908994906 1:70139891-70139913 AAGTACTGAATGACAGAGAAGGG + Intronic
909972308 1:82005270-82005292 CAATGCTGGATGGAAGATAAGGG + Intergenic
911110161 1:94175544-94175566 AAGGACTGGGTGGCAGAGAAAGG - Intronic
912713079 1:111963393-111963415 AAGTACTGAATGACAGAGAAGGG - Intronic
913073809 1:115324357-115324379 ATGAACTGGAAGGCAGATAAGGG - Intronic
913253592 1:116933816-116933838 AACTACTGAAAGGCAGAGAAAGG - Intronic
915871049 1:159559992-159560014 ACCTACTGAATGATAGATAAGGG + Intergenic
919797446 1:201329772-201329794 AACAACTTGAAGGCAGAAAAGGG + Intronic
919941509 1:202289918-202289940 TATTACTGGATCACAGATAAGGG - Intronic
923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG + Intronic
1063709314 10:8461782-8461804 AGCTACTGAATAGCAGCTAATGG + Intergenic
1065635113 10:27724300-27724322 AACTGCTGGACTGCAGATAGGGG - Intronic
1068161363 10:53269291-53269313 AACTACTAGATGGGGGAGAAAGG + Intergenic
1071285189 10:84138223-84138245 AACTACTGCTTAGGAGATAAAGG + Intergenic
1071382379 10:85080615-85080637 AATAACTGGATGGCAGATGGTGG + Intergenic
1074017898 10:109553277-109553299 TACTACTTGATGGCACAAAAGGG - Intergenic
1074731799 10:116386145-116386167 AACTGTTGATTGGCAGATAATGG + Intergenic
1075811140 10:125225923-125225945 AATGAATGTATGGCAGATAATGG + Intergenic
1077521167 11:3035879-3035901 AGCTCCTGGATGCCAGCTAATGG - Intronic
1078773845 11:14375974-14375996 AACTACTGGGTGGCAGGTACAGG + Intergenic
1083090282 11:60192303-60192325 AACTACTTGCTGGCAGCTGAAGG + Intergenic
1085088759 11:73691591-73691613 ATCTACTGCATGTCAGATACTGG - Intronic
1088148826 11:106718945-106718967 AAAGACTGGATGTCAGAGAAAGG - Intronic
1088787613 11:113196819-113196841 AACTACTGGAGGGAAAATAAAGG - Intronic
1089842963 11:121434818-121434840 AACAGCTGGATGGAAGAAAACGG + Intergenic
1090648431 11:128785429-128785451 AGCTACTAGATGGCAGAGCAAGG + Intronic
1091192994 11:133709727-133709749 AATTGATGGAAGGCAGATAAAGG - Intergenic
1092699713 12:11214602-11214624 AATAAATGGATGGCAGATCATGG + Intergenic
1093914087 12:24781240-24781262 AACAACTGTATGGTAAATAAAGG + Intergenic
1095244062 12:39898461-39898483 AACTACTGAGTGGCAGAATATGG - Intronic
1095362594 12:41361686-41361708 TGCTACTGAATGTCAGATAAAGG + Intronic
1096633860 12:52946334-52946356 ATATACAGGAGGGCAGATAAAGG - Intronic
1096934566 12:55257154-55257176 AGCAAGTGGATGGCAGATGATGG + Intergenic
1098698960 12:73598187-73598209 AAGTACTGTATTGCAGATAAAGG + Intergenic
1100293047 12:93235607-93235629 AACTGGTGGAGGGCAGAGAAGGG + Intergenic
1101618769 12:106363170-106363192 AACAAGTGGATGGCAATTAAAGG - Intronic
1102657371 12:114493848-114493870 AATTACACGATGGCAGAAAAGGG - Intergenic
1103041822 12:117702126-117702148 AACTACTGGGGAGCAGACAAGGG - Intronic
1103306057 12:119965084-119965106 AATTATTGGATGGCATATGATGG - Intergenic
1104530024 12:129561031-129561053 AATTACTGGATGACAGATAATGG + Intronic
1105817555 13:24051032-24051054 AGCTGGTGGATGGCAGATATGGG - Intronic
1108246653 13:48522155-48522177 AACTACTGGATGGCCTCTTACGG + Intronic
1108708616 13:53012057-53012079 AACTTCTGGCTGGAGGATAAAGG + Intergenic
1110121901 13:71892960-71892982 AACTACAGAAAAGCAGATAAAGG - Intergenic
1110844498 13:80178712-80178734 AGCTACTGGCTGTCATATAATGG + Intergenic
1111908731 13:94286250-94286272 AACAACTGGATGAAAAATAATGG - Intronic
1112466658 13:99651123-99651145 AGCTACTGGAAGGCAGAGGAAGG - Intronic
1116618472 14:47168139-47168161 AACTCCTTCATGGCAGAGAAGGG - Intronic
1125183482 15:36904325-36904347 AACTACTGCATTGCAAAAAATGG - Intronic
1133362292 16:5184043-5184065 AACTAATGAGCGGCAGATAAGGG - Intergenic
1133853155 16:9524934-9524956 TAGGAATGGATGGCAGATAATGG - Intergenic
1134324527 16:13194863-13194885 AACAAATGGATGGTGGATAATGG + Intronic
1135402378 16:22174915-22174937 GACTCCTGGAAGGCAGATATTGG - Intronic
1137430613 16:48415339-48415361 AAAGACTGGAAGGCAGATAGAGG + Intronic
1141899300 16:86980012-86980034 AACTAATGGATGACAGATGGTGG + Intergenic
1144148985 17:12425063-12425085 TTCTACTGAATGGGAGATAAAGG - Intergenic
1144232030 17:13217134-13217156 ATCAACTGGATGGCAGATAGTGG + Intergenic
1146940350 17:36839839-36839861 AACCTCTGGATGGTAGAAAAGGG - Intergenic
1147390507 17:40106499-40106521 ATGTACTGGATGCCAGAAAAAGG - Intergenic
1148649437 17:49239029-49239051 ATCTGCTGGATGACAGAAAATGG - Intergenic
1154946009 18:21161940-21161962 AGCTAGTAGATGGCAGATCATGG - Intergenic
1155743101 18:29314967-29314989 AAATACTGGCTGGCACAGAAGGG - Intergenic
1158042292 18:53109789-53109811 AACTACTGGAAGGAAAAAAAAGG - Intronic
1159292197 18:66437755-66437777 AAATAATGGCTGGCAAATAATGG + Intergenic
1166287284 19:41839077-41839099 AACTCTTGGTTGGCAGTTAACGG - Intronic
1168069335 19:53941256-53941278 AGCTCCTGGATGGCAGATTTAGG + Intronic
925634217 2:5927066-5927088 AATTACTGGATGAAAGATGAGGG + Intergenic
925794299 2:7526171-7526193 AAAGACTGGATGGCTTATAAAGG + Intergenic
926361063 2:12087841-12087863 AGCTTGTGGATGGCAGATCACGG - Intergenic
927113354 2:19879642-19879664 AACTAGTGCAAGGCAGAAAATGG - Intergenic
928899053 2:36298218-36298240 ACCTGCTGGATGACAAATAATGG + Intergenic
931464468 2:62474571-62474593 ACCTACTGTATGGCAGCTACTGG + Intergenic
931714622 2:65019361-65019383 AACTACTAGATGGCAAATCTGGG - Intronic
932366736 2:71157733-71157755 AACTACTCCCTGGCAGAAAAGGG + Intergenic
934138593 2:89022052-89022074 AACTACTAGAGGGGAGACAAAGG - Intergenic
934230652 2:90178511-90178533 AACTACTAGAGGGGAGACAAAGG + Intergenic
935679286 2:105621986-105622008 AGCTACTGGAAGTCAGAGAAAGG + Intergenic
936869776 2:117122143-117122165 AACTACTAGAGATCAGATAAAGG - Intergenic
937723186 2:125127076-125127098 AAGTACTGGATGGGGGATCATGG - Intergenic
938695376 2:133830359-133830381 AACAACAGGATGGGAGAGAAAGG + Intergenic
938829664 2:135037916-135037938 AACTACTGGATCAGAGAAAAAGG - Intronic
940181077 2:150933800-150933822 GAATTCTGGAGGGCAGATAATGG + Intergenic
940764172 2:157771927-157771949 AAATACTGGCTGCCAGAAAATGG + Intronic
941712963 2:168733945-168733967 AAATACTGCAGGGCAGATCAAGG + Intronic
942673345 2:178400886-178400908 TACTACTTGATGGCGGATACTGG - Intergenic
945478251 2:210312703-210312725 GCCTTCTGGATGGAAGATAAAGG + Intronic
948290713 2:236822317-236822339 ATCCACTGGATGTCAGATGATGG + Intergenic
948396037 2:237645818-237645840 AACATCTGGATTGCAGAGAAGGG + Intronic
1170047351 20:12099529-12099551 AACTACTGGAAGGGAGAGGAAGG + Intergenic
1170514411 20:17113666-17113688 AAGTAATGGATGGCAAATAATGG - Intergenic
1171891468 20:30721526-30721548 AACTTTTGAATGGCAGTTAAAGG + Intronic
1177354923 21:19996058-19996080 AACTACTTGCTGGCAGCTGAAGG - Intergenic
1177638901 21:23820956-23820978 AGCTAGTGAATGGCAGATGATGG + Intergenic
1177671245 21:24231839-24231861 AATTAATGGATGGCAGATGTGGG - Intergenic
1180592188 22:16949842-16949864 AACTACTTGATGTCAGAGAAGGG + Intergenic
1181832002 22:25567408-25567430 TACCACTGGATGGCAGTTAGTGG + Intronic
1184566969 22:45297894-45297916 AGCTACTGGAGGGCCGGTAAAGG + Intergenic
1185234601 22:49704737-49704759 AGGTACTGGAGGCCAGATAAGGG + Intergenic
950327607 3:12126644-12126666 AACTACTGGGTGGAAGATTCAGG - Intronic
953475155 3:43199415-43199437 TTCTACTGGATGCTAGATAATGG - Intergenic
953685091 3:45071430-45071452 AAGTCCTGGGTTGCAGATAATGG - Intergenic
955704284 3:61712220-61712242 AAATAATCGATGGCAGTTAAAGG - Intronic
957813893 3:85265897-85265919 TAATACTGGAGGGCAGAAAAAGG - Intronic
958997271 3:100918883-100918905 ACCTACTGTATGGCAGGTAAAGG - Intronic
961398547 3:126616416-126616438 ATCTACAGAATGGCAGAAAAAGG + Intronic
963187039 3:142430057-142430079 AATTATTGGATCACAGATAAAGG + Intronic
963476461 3:145811410-145811432 AACTTCTAGATGCCAGATACTGG - Intergenic
969878381 4:10152988-10153010 ACCTACAGGAATGCAGATAAGGG + Intergenic
970310960 4:14782062-14782084 AACTTCTTGAAGGCAAATAATGG + Intergenic
972140148 4:35948623-35948645 AACTACTGGAAGGCATCTAGAGG + Intronic
974221157 4:58973334-58973356 AACTACAGAATGGGAGAAAATGG - Intergenic
974429912 4:61782662-61782684 AACTACTAAATGGTAGAAAATGG + Intronic
975280064 4:72551573-72551595 ATCTCCTGGATGGTAGTTAATGG + Intronic
975675949 4:76827918-76827940 AACTAGTGGGTGACAGCTAAAGG + Intergenic
979452227 4:120885998-120886020 ATCTTATGAATGGCAGATAAAGG + Intronic
980248132 4:130274505-130274527 AACTATATGATGGCACATAATGG - Intergenic
981783901 4:148456234-148456256 AAATACAGGAGGGCAGTTAATGG + Intergenic
981844367 4:149150882-149150904 AACTAGTGAATGGCAGAAACAGG + Intergenic
983524118 4:168743020-168743042 AGCTCCTGGAAGGCAGAGAATGG - Intronic
984225716 4:177032590-177032612 AACAACTGGAATCCAGATAAAGG + Intergenic
993149762 5:84146108-84146130 CACTACAGGATGGCAGTTAATGG + Intronic
994027645 5:95103385-95103407 AACAACTGTATGGCATATATGGG + Intronic
996704375 5:126482146-126482168 AACTAGTGGTTGCCAGAGAATGG + Intronic
997705240 5:135944403-135944425 AACTAGTGGATTCTAGATAAAGG + Intronic
999687950 5:154119010-154119032 GACTAGTGGGTGGCAGAGAAAGG - Intronic
999699138 5:154212083-154212105 AACTTCTGGAGGGCAGACACTGG - Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007957063 6:45927654-45927676 AGCAAATGAATGGCAGATAAAGG - Intronic
1008263650 6:49397474-49397496 AATTATTGGATGACAGAGAATGG + Intergenic
1009548286 6:65050758-65050780 AAAGACTGGAGTGCAGATAATGG - Intronic
1010167176 6:72929688-72929710 AACTATTGGATAGAAGAAAATGG + Intronic
1011330651 6:86202452-86202474 AAATACAGGATGGTAGGTAAAGG + Intergenic
1012805886 6:103892289-103892311 AACTACTCGATTGAATATAATGG + Intergenic
1014634287 6:123825532-123825554 AACTACTGTATGCCAGCAAATGG + Intronic
1015543588 6:134340141-134340163 AGCTACTTTATGGCACATAAAGG + Intergenic
1015881119 6:137870801-137870823 GAGTACTGGATGCCAGTTAAGGG - Intronic
1015895920 6:138016695-138016717 AAAAAATGGATGGCAGATTATGG - Intergenic
1017739768 6:157396410-157396432 ACATTCTTGATGGCAGATAAGGG + Intronic
1021442547 7:20693252-20693274 AGCTACTGGAAGGCTGATATAGG + Intronic
1022119713 7:27296405-27296427 AATTACTGGAGGGATGATAAAGG - Intergenic
1022715685 7:32895889-32895911 AGCTACTGAATGGCAGATTGAGG - Intergenic
1026858042 7:73767970-73767992 AATGACTGGATGGAACATAAAGG - Intergenic
1026907173 7:74069143-74069165 ACCAACTGGATGGCAGCCAACGG - Intronic
1030554923 7:111011903-111011925 AAATACAGGATGGCAGGAAATGG - Intronic
1033520168 7:142152512-142152534 AAATACTGAATGGCTTATAATGG - Intronic
1038392734 8:27219577-27219599 AAGTTCCAGATGGCAGATAAGGG - Intergenic
1042108098 8:65349947-65349969 ACCTACTTGAGGGCAGAGAATGG - Intergenic
1043710768 8:83415380-83415402 AAATAATGGATGACAGATAATGG - Intergenic
1044726985 8:95202039-95202061 AACAACTTGCTGGGAGATAAGGG + Intergenic
1044844263 8:96364837-96364859 AACTTCTGGATGGGGGATCATGG + Intergenic
1046640625 8:116726442-116726464 AACTCCTGGATGCCAGACCATGG - Intronic
1046864353 8:119129368-119129390 AATTACTGGAAGCCAGAGAACGG + Intergenic
1051031172 9:12680940-12680962 AAGTCCTACATGGCAGATAAAGG + Intergenic
1054998525 9:71421561-71421583 AACTAATGGTAGGTAGATAAAGG - Intronic
1056920329 9:90782090-90782112 AACTAGTGGAAGGCTGAGAAAGG + Intergenic
1057953667 9:99390108-99390130 AACTAGGGGTTGGCAGATTATGG + Intergenic
1058157563 9:101532552-101532574 AACTACTGAATGGCAAGTAATGG - Intronic
1062685976 9:137813687-137813709 AAGAGCTGGAAGGCAGATAAAGG + Intronic
1203561087 Un_KI270744v1:59341-59363 AACTTTTGAATGGCAGTTAAAGG + Intergenic
1186072609 X:5838766-5838788 AACTAATGCATGGCAGTGAAGGG + Intergenic
1186787417 X:12966687-12966709 AAGTACTTGTAGGCAGATAAAGG - Intergenic
1186997961 X:15143799-15143821 AAGTCCTGGATGGCAGAAGATGG - Intergenic
1187188759 X:17013015-17013037 AACAACTGTTTTGCAGATAAGGG - Intronic
1190044095 X:47098760-47098782 AACTACTGGGTGGTACACAATGG - Intergenic
1190575599 X:51833916-51833938 AAATACTGAATTGAAGATAATGG - Intronic
1192113848 X:68392511-68392533 AAATACTGGATGGAAGAGAGTGG + Intronic
1194903748 X:99547677-99547699 ATCTAATGAATGGCAGAAAATGG + Intergenic
1195771412 X:108355324-108355346 AACTACTGGATGGTATATTTTGG - Intronic
1197329012 X:125130784-125130806 GAACACTGGCTGGCAGATAATGG - Intergenic
1199744627 X:150764159-150764181 AACTACTGGATTCCAGGCAAAGG + Intronic
1199808291 X:151324257-151324279 GACTGATGGATGGCAGAGAAGGG - Intergenic
1202095572 Y:21245437-21245459 AACCACTGGGTGCCAAATAAGGG - Intergenic