ID: 923615174

View in Genome Browser
Species Human (GRCh38)
Location 1:235531373-235531395
Sequence CTGGGTTCCTATATTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615174_923615179 8 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615179 1:235531404-235531426 CTAGCCAGCAGGCCCATCATGGG No data
923615174_923615177 -3 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615177 1:235531393-235531415 CAGATTTTGCTCTAGCCAGCAGG No data
923615174_923615182 13 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG No data
923615174_923615186 20 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615186 1:235531416-235531438 CCCATCATGGGGCTGGGGCCTGG No data
923615174_923615180 9 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615180 1:235531405-235531427 TAGCCAGCAGGCCCATCATGGGG No data
923615174_923615178 7 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615178 1:235531403-235531425 TCTAGCCAGCAGGCCCATCATGG No data
923615174_923615183 14 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615183 1:235531410-235531432 AGCAGGCCCATCATGGGGCTGGG No data
923615174_923615184 15 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615184 1:235531411-235531433 GCAGGCCCATCATGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615174 Original CRISPR CTGGGTTCCTATATTGAGTC TGG (reversed) Intergenic