ID: 923615176

View in Genome Browser
Species Human (GRCh38)
Location 1:235531392-235531414
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615176_923615186 1 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615186 1:235531416-235531438 CCCATCATGGGGCTGGGGCCTGG No data
923615176_923615184 -4 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615184 1:235531411-235531433 GCAGGCCCATCATGGGGCTGGGG No data
923615176_923615189 22 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data
923615176_923615182 -6 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG No data
923615176_923615180 -10 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615180 1:235531405-235531427 TAGCCAGCAGGCCCATCATGGGG No data
923615176_923615183 -5 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615183 1:235531410-235531432 AGCAGGCCCATCATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615176 Original CRISPR CTGCTGGCTAGAGCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr