ID: 923615177

View in Genome Browser
Species Human (GRCh38)
Location 1:235531393-235531415
Sequence CAGATTTTGCTCTAGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615174_923615177 -3 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615177 1:235531393-235531415 CAGATTTTGCTCTAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615177 Original CRISPR CAGATTTTGCTCTAGCCAGC AGG Intergenic
No off target data available for this crispr