ID: 923615178

View in Genome Browser
Species Human (GRCh38)
Location 1:235531403-235531425
Sequence TCTAGCCAGCAGGCCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615174_923615178 7 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615178 1:235531403-235531425 TCTAGCCAGCAGGCCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615178 Original CRISPR TCTAGCCAGCAGGCCCATCA TGG Intergenic
No off target data available for this crispr