ID: 923615179

View in Genome Browser
Species Human (GRCh38)
Location 1:235531404-235531426
Sequence CTAGCCAGCAGGCCCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615174_923615179 8 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615179 1:235531404-235531426 CTAGCCAGCAGGCCCATCATGGG No data
923615175_923615179 -10 Left 923615175 1:235531391-235531413 CCCAGATTTTGCTCTAGCCAGCA No data
Right 923615179 1:235531404-235531426 CTAGCCAGCAGGCCCATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615179 Original CRISPR CTAGCCAGCAGGCCCATCAT GGG Intergenic
No off target data available for this crispr