ID: 923615182

View in Genome Browser
Species Human (GRCh38)
Location 1:235531409-235531431
Sequence CAGCAGGCCCATCATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615174_923615182 13 Left 923615174 1:235531373-235531395 CCAGACTCAATATAGGAACCCAG No data
Right 923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG No data
923615176_923615182 -6 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG No data
923615175_923615182 -5 Left 923615175 1:235531391-235531413 CCCAGATTTTGCTCTAGCCAGCA No data
Right 923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615182 Original CRISPR CAGCAGGCCCATCATGGGGC TGG Intergenic
No off target data available for this crispr