ID: 923615187 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:235531417-235531439 |
Sequence | GCCAGGCCCCAGCCCCATGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923615187_923615189 | -3 | Left | 923615187 | 1:235531417-235531439 | CCATCATGGGGCTGGGGCCTGGC | No data | ||
Right | 923615189 | 1:235531437-235531459 | GGCCCTGTGAGCCTTCCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923615187 | Original CRISPR | GCCAGGCCCCAGCCCCATGA TGG (reversed) | Intergenic | ||