ID: 923615189

View in Genome Browser
Species Human (GRCh38)
Location 1:235531437-235531459
Sequence GGCCCTGTGAGCCTTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923615175_923615189 23 Left 923615175 1:235531391-235531413 CCCAGATTTTGCTCTAGCCAGCA No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data
923615181_923615189 6 Left 923615181 1:235531408-235531430 CCAGCAGGCCCATCATGGGGCTG No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data
923615185_923615189 -2 Left 923615185 1:235531416-235531438 CCCATCATGGGGCTGGGGCCTGG No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data
923615176_923615189 22 Left 923615176 1:235531392-235531414 CCAGATTTTGCTCTAGCCAGCAG No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data
923615187_923615189 -3 Left 923615187 1:235531417-235531439 CCATCATGGGGCTGGGGCCTGGC No data
Right 923615189 1:235531437-235531459 GGCCCTGTGAGCCTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923615189 Original CRISPR GGCCCTGTGAGCCTTCCCAG TGG Intergenic
No off target data available for this crispr