ID: 923616413

View in Genome Browser
Species Human (GRCh38)
Location 1:235541972-235541994
Sequence GGTCAAATCTGCATTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 18, 3: 21, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923616413 Original CRISPR GGTCAAATCTGCATTCACAG GGG Intergenic
901348899 1:8574155-8574177 GGTCAAATAAGAAATCACAGTGG - Intronic
902180821 1:14687077-14687099 GGTCAATTTTTCATTCAGAGGGG - Intronic
903548656 1:24142733-24142755 GGCCAATTCTCCATTCACTGAGG + Intronic
904442149 1:30539007-30539029 GGCCTAATCTGAATTCTCAGAGG - Intergenic
910718151 1:90255526-90255548 GGTCAAGTGTGCATTTCCAGAGG + Intergenic
910910721 1:92230910-92230932 GGTGACATCTGCACACACAGTGG - Intronic
911598312 1:99821690-99821712 GGACAAATCCACAGTCACAGTGG - Intergenic
918318743 1:183345239-183345261 GGTCAAATATTCAACCACAGTGG - Intronic
919790446 1:201286974-201286996 GGTGTGATCTGTATTCACAGTGG - Intronic
920521897 1:206634103-206634125 GAGCAATTCTGCTTTCACAGGGG - Intergenic
922176535 1:223202080-223202102 AGCCAAATCAGCATTCAGAGGGG + Intergenic
923616413 1:235541972-235541994 GGTCAAATCTGCATTCACAGGGG + Intergenic
924653374 1:245949924-245949946 TTTTAAATTTGCATTCACAGGGG - Intronic
1063113928 10:3060061-3060083 GGGCTAATCTGCAACCACAGAGG - Intergenic
1063600721 10:7478452-7478474 GGTCAAATATGCAATCAAATGGG + Intergenic
1065454557 10:25893347-25893369 GGTCAAATCAACCTTTACAGGGG - Intergenic
1067853497 10:49770014-49770036 GGTGAAACCTCCATTCACTGGGG - Intergenic
1069629631 10:69889756-69889778 GGTTTCATCTGCACTCACAGGGG + Intronic
1072810641 10:98458847-98458869 GGGGGAATCTGGATTCACAGAGG + Intronic
1074729895 10:116359966-116359988 GGTAAAGTTTGCATTCACAATGG + Intronic
1077395076 11:2316617-2316639 GGTCCAAGCTGCAGCCACAGCGG - Exonic
1078095787 11:8296066-8296088 GGCCAAATCTGCTTCCACACAGG + Intergenic
1079507918 11:21175184-21175206 CGTCAATTCTGCATTCTGAGTGG + Intronic
1083268244 11:61557086-61557108 GGTCTGATCTGCATTTACAGAGG - Intronic
1083443923 11:62694634-62694656 GCCCAAATCTTGATTCACAGGGG + Exonic
1090489201 11:127143209-127143231 GGTATGATCTGCATCCACAGTGG + Intergenic
1090708801 11:129366421-129366443 GGTCAAATGGGGGTTCACAGGGG - Intergenic
1091523217 12:1269323-1269345 GGACAAAGCCGCTTTCACAGAGG - Intronic
1093150109 12:15610932-15610954 GGTCAAATGAGTTTTCACAGGGG - Intergenic
1094630424 12:32168659-32168681 GGTCAACTTTGGATACACAGTGG - Intronic
1095877236 12:47094037-47094059 GTACAAATCAGCACTCACAGTGG - Intronic
1097536221 12:60873340-60873362 GGGCATCTCTGCATTCTCAGGGG - Intergenic
1100724574 12:97395194-97395216 TGACAACCCTGCATTCACAGGGG + Intergenic
1101572493 12:105966695-105966717 GCTCACTTCTGCATTCACAGTGG + Intergenic
1101825841 12:108219326-108219348 GATCACATTTGCATTCCCAGAGG + Intronic
1105305502 13:19166001-19166023 GGTGGGGTCTGCATTCACAGAGG + Intergenic
1109228248 13:59723117-59723139 GAACACATCTGCATTCAGAGTGG - Intronic
1110816615 13:79867298-79867320 GGTCAAATCTGTTTTCAAATGGG + Intergenic
1111587483 13:90300746-90300768 AGTAAAATCTGCATTCACGGTGG + Intergenic
1112666395 13:101579406-101579428 GGCAAAATCTGCAGTAACAGAGG + Exonic
1112790993 13:103002086-103002108 GGCCAAAGCAGCATTCAAAGTGG - Intergenic
1116569429 14:46496772-46496794 GAGCAAATATGCACTCACAGTGG + Intergenic
1122388858 14:101366679-101366701 AGTCAAATTTGCAGACACAGAGG + Intergenic
1124177085 15:27436355-27436377 GCTCAAATCCGAATTCCCAGTGG - Intronic
1124375870 15:29128297-29128319 GGTCAAATCCCCAGACACAGAGG - Intronic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1131421052 15:92305728-92305750 ATTCTAATGTGCATTCACAGCGG + Intergenic
1132830977 16:1928184-1928206 GGCCCAGTCTGCATGCACAGAGG + Intergenic
1137615897 16:49846764-49846786 GTTCAAAACTGCAGCCACAGGGG + Intronic
1141340496 16:83199578-83199600 GGTAATAACTGCATTCACTGAGG - Intronic
1141910386 16:87054521-87054543 CATCAGATCTGTATTCACAGAGG - Intergenic
1142418283 16:89954989-89955011 CGTCCAGTCTGCATTCACAGAGG - Intronic
1144403526 17:14929785-14929807 GGTTAAATCTCCATGAACAGTGG + Intergenic
1144937059 17:18908310-18908332 GGACTCATCTGCATTCTCAGTGG - Intronic
1146292361 17:31618275-31618297 GGTCAAAGATGAATTCACAAGGG - Intergenic
1152206408 17:78976852-78976874 GATCAAACCAGCAGTCACAGGGG - Intronic
1153261472 18:3228177-3228199 GGTGACACCTGCAGTCACAGTGG + Intergenic
1155057610 18:22198683-22198705 GGTTAAATCTGGATCCACACTGG + Intronic
1156297003 18:35801704-35801726 GGTCAAATCTGTATTTTCAGGGG + Intergenic
1156315801 18:35967654-35967676 GGTCAAAGATGAAATCACAGGGG + Intergenic
1156655023 18:39274905-39274927 GGTCAGAACTCCATTCAGAGGGG - Intergenic
1158802019 18:60922978-60923000 GGTCCAATCTGCATTGCCAATGG + Intergenic
1162728445 19:12703427-12703449 GGTGAAATCTGCATGCAGATGGG - Exonic
1164791643 19:30990437-30990459 GGTCACAGATCCATTCACAGTGG + Intergenic
1165592972 19:36986997-36987019 ACTCAAATCTGCAGTTACAGTGG - Intronic
1165656851 19:37541139-37541161 GGTGAAATCTGAAACCACAGGGG + Exonic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
928136979 2:28695155-28695177 GGTGAAATCAGCATCCTCAGAGG + Intergenic
930501194 2:52220614-52220636 GGCCAAATCTTCATTCACATAGG - Intergenic
930829730 2:55730223-55730245 GGGCAAATCTGCCTTCCAAGTGG + Intergenic
932968564 2:76509449-76509471 CATCAAATCTGCCTTCACAGAGG + Intergenic
933986559 2:87596630-87596652 GGTCACATCTGCAGCTACAGAGG - Intergenic
934146398 2:89098900-89098922 GGTCAGTTATGCAATCACAGTGG - Intergenic
934222869 2:90101675-90101697 GGTCAGTTATGCAATCACAGCGG + Intergenic
936287960 2:111195963-111195985 GGTCTAATTTTCATACACAGTGG + Intergenic
936418170 2:112338695-112338717 GGTGAAATTTGCATTATCAGAGG + Exonic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
943736863 2:191365855-191365877 GGTGAAGTCTGCAGTCAGAGTGG + Intronic
944154586 2:196595987-196596009 GGTCAATTCTGCATTGAAACTGG + Intergenic
944304795 2:198166850-198166872 GCTTAGTTCTGCATTCACAGGGG - Intronic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945119132 2:206440771-206440793 AATCAAATCAGCATTCATAGAGG - Intergenic
946866025 2:224041632-224041654 TGTCAATTCTGAAATCACAGTGG + Intergenic
948376447 2:237524106-237524128 GGTCAAATCCTCATTGACAGGGG + Intronic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1172144271 20:32745154-32745176 GGTCAATTCTGACTTCTCAGAGG - Intergenic
1174141513 20:48417464-48417486 AGTAAAATTTGAATTCACAGTGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1178435061 21:32550919-32550941 GGTCAAATCTGCTCCAACAGTGG - Intergenic
1179223539 21:39431215-39431237 GGACAACTCAGCATCCACAGAGG - Intronic
1179646217 21:42777976-42777998 GGTCAAAGCTGAAATCACAGGGG - Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
1183370695 22:37430424-37430446 GGTGCAATCTCCACTCACAGTGG + Intergenic
951227936 3:20142734-20142756 GATGAAATCTGCATTAGCAGAGG + Intronic
951859761 3:27238943-27238965 GGCCAAATCTTCATTTATAGAGG - Intronic
957203800 3:77168755-77168777 GGTCCAATTTGCCTTCACAGAGG + Intronic
957599746 3:82319253-82319275 GATGAAATCTGCCATCACAGCGG - Intergenic
959194251 3:103158330-103158352 GGTCAAGTCTTCATTTACACAGG - Intergenic
959390273 3:105763957-105763979 GGTGACATCTGCATACACTGTGG + Intronic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
960089806 3:113627821-113627843 AGCCAACTCTGCATTCACACAGG + Exonic
962892708 3:139686512-139686534 GCTCAAATCTGCCTTCAGAAAGG - Intergenic
964182910 3:153909042-153909064 AGTCAAATCTGTATGCAGAGTGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
970228449 4:13883933-13883955 GGCCAAGTCTTCATTCGCAGAGG - Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
973827093 4:54719168-54719190 GGGCAAATGTGCATTTATAGCGG + Intronic
975952171 4:79787507-79787529 AGTTAAATCTGCATTTTCAGAGG - Intergenic
980067904 4:128210500-128210522 GTTCAAATATGAATTGACAGTGG - Exonic
985959490 5:3289742-3289764 GCTCACATCTGAATTCACATGGG + Intergenic
987109105 5:14668122-14668144 GATGAAATCTGAATTCTCAGAGG + Intronic
989299036 5:39866791-39866813 GGTCAAATCTGATTTCAAAAGGG + Intergenic
989989443 5:50743659-50743681 GCTCAAATCTGTAATCCCAGAGG + Intronic
990606653 5:57417220-57417242 GGTGAACTTTGCTTTCACAGAGG + Intergenic
992511860 5:77444584-77444606 GGGCAAATCTGTTTTCAGAGGGG - Intronic
993204323 5:84860995-84861017 GGAGAAAGCTGCAGTCACAGAGG - Intergenic
997600247 5:135134091-135134113 GGTCAAAGGTGGCTTCACAGAGG - Intronic
998243795 5:140477286-140477308 GGTCAGATCTGCATTTGTAGTGG + Intronic
1001833745 5:174812041-174812063 GTTCAAAACTGCAATCAAAGTGG - Intergenic
1004377921 6:15106744-15106766 GGTCAAATTCCCATTCCCAGAGG - Intergenic
1007654300 6:43443004-43443026 GGCCACATCTGCATCCACAGCGG - Exonic
1008014255 6:46500714-46500736 AGTCAAACCTGCCTTCATAGTGG + Intergenic
1010883725 6:81211712-81211734 GGTCAAAGCTGATTTCACATGGG - Intergenic
1011038540 6:83004269-83004291 GGAAAAATATACATTCACAGTGG + Intronic
1011128618 6:84033015-84033037 GGTCAAAGATGGCTTCACAGTGG - Intergenic
1013296680 6:108763972-108763994 GGTCAAATTTACCTTAACAGAGG + Intergenic
1014646593 6:123981478-123981500 GGGAAGGTCTGCATTCACAGGGG - Intronic
1016705775 6:147105640-147105662 GGACAAATCTGCAATCACACTGG - Intergenic
1017616865 6:156255219-156255241 GGTCAAATCTGCTCCAACAGTGG - Intergenic
1021896053 7:25237064-25237086 GGTCCAATGTGCACCCACAGTGG - Intergenic
1023170408 7:37385799-37385821 CGGCCAATCTGCCTTCACAGAGG + Intronic
1024768064 7:52684770-52684792 AGTCAAATTTACATTCACAACGG + Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1032839823 7:135704850-135704872 GGTGAAATCAGCGTTCACAGTGG - Intronic
1033426343 7:141247999-141248021 GGTCACATATGCATTAACAGAGG - Intronic
1033594026 7:142841575-142841597 AGTCATATCTTCATTCCCAGAGG - Intergenic
1035327172 7:158072702-158072724 GATCAACTGTGCACTCACAGGGG + Intronic
1036016735 8:4793704-4793726 GGCCAAATCTTCTTTTACAGGGG + Intronic
1036506351 8:9360004-9360026 GGCCAACTCTGCATTCAGGGAGG - Intergenic
1037333715 8:17770906-17770928 GATTAAATCAGCATTCACTGTGG + Intronic
1040603136 8:48903982-48904004 AGTCACCTCAGCATTCACAGCGG + Intergenic
1041798666 8:61773861-61773883 AATCACATCTGCATCCACAGAGG + Intergenic
1042578785 8:70253125-70253147 GGTGATAACTGCAGTCACAGTGG + Intronic
1043593385 8:81855876-81855898 GGCCAAATCTTCATTTACATAGG - Intergenic
1046993221 8:120485304-120485326 GGTCAAATATGAAATCACAATGG - Intronic
1050097444 9:2081465-2081487 TGCCAAATCTGCCTTCACATTGG + Intronic
1050387589 9:5107328-5107350 GGTCAAATCTGCCTTCATAGGGG - Intronic
1053504234 9:38627530-38627552 GGTCAAGTCTGCAAGCACAACGG - Intergenic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1057072350 9:92110272-92110294 GATCAAATCTACATTCATAAAGG - Intronic
1057152144 9:92806086-92806108 GGTCAAGTCTGCAAGCACAACGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1060978842 9:127780867-127780889 GGGCAGAGCTGCATTCCCAGTGG - Intergenic
1061161766 9:128899445-128899467 GTTCAAACCTGGATTTACAGTGG - Intronic
1061656117 9:132091574-132091596 GGCCAAATCTGTCTTTACAGAGG + Intergenic
1202800781 9_KI270719v1_random:174266-174288 TGTCCACTCTGCAGTCACAGGGG - Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1185990061 X:4883917-4883939 GGTCAGAGCTGCAGGCACAGAGG - Intergenic
1189050761 X:37642856-37642878 GGCCAATTCTGAATTCATAGTGG - Intronic
1189097322 X:38154409-38154431 AGTTAAAAATGCATTCACAGGGG + Intronic
1190499045 X:51057012-51057034 GGATAAATCTGGATTCACATTGG + Intergenic
1190506895 X:51135432-51135454 GGGTAAATCTGGATTCACACAGG - Intergenic
1190540492 X:51472968-51472990 GGTCAAATAAGAAGTCACAGTGG - Intergenic
1194003199 X:88457524-88457546 GGTCACAACTGCAATCACAGAGG + Intergenic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1199499113 X:148489781-148489803 GGTTAATTCTGCATTCAGATTGG - Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic