ID: 923621326

View in Genome Browser
Species Human (GRCh38)
Location 1:235581860-235581882
Sequence GAAGACACCCGGTCCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923621322_923621326 9 Left 923621322 1:235581828-235581850 CCTAAGTGACTCTTGAAGAAGCC No data
Right 923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923621326 Original CRISPR GAAGACACCCGGTCCTCACA GGG Intronic
900891924 1:5455743-5455765 GACCAAACCCGGTCCTCCCAGGG + Intergenic
904132293 1:28283884-28283906 GAACAGACCCTTTCCTCACAGGG - Intergenic
904132443 1:28284962-28284984 GAACAGACCCTTTCCTCACACGG + Intergenic
915663112 1:157420044-157420066 AAAAACACCTTGTCCTCACATGG - Intergenic
919788107 1:201273008-201273030 GGAGCCAGCTGGTCCTCACACGG + Intergenic
922125099 1:222713458-222713480 GAGGACTCCCGCTCCTAACAAGG - Intronic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
924245449 1:242079368-242079390 GAAGACAGCCCCTCCTCTCAGGG - Intergenic
1066220680 10:33334822-33334844 GCAGACACCCGGACCTCCCCTGG - Exonic
1066270922 10:33822784-33822806 GAAGCCATGCTGTCCTCACAAGG + Intergenic
1070754100 10:78981148-78981170 GAAGACACCCAGTTCTGACTTGG + Intergenic
1071875295 10:89837611-89837633 GAGGACACTCCGACCTCACATGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1086444291 11:86857928-86857950 GGAGACAGCCCGTCCTCACTGGG - Intronic
1089667038 11:120027025-120027047 GAACACACCCGAACCTCAGAAGG + Intergenic
1095927430 12:47592867-47592889 GAAGACACCAGTTTCTCACAGGG - Intergenic
1097473269 12:60021835-60021857 GAAAAGACCCAGTCCTCCCAGGG - Intergenic
1102891008 12:116558546-116558568 GATGACACGAGGTCGTCACAAGG - Intergenic
1102968226 12:117145621-117145643 AAAGACACACAGTCCTCACTCGG + Exonic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1114055943 14:18967213-18967235 GAAAACACCCGGCCCACCCAAGG - Intergenic
1114106606 14:19434540-19434562 GAAAACACCCGGCCCACCCAAGG + Intergenic
1114424881 14:22613208-22613230 GAAGACACAGGGTCCTGAGATGG - Exonic
1114732401 14:25007467-25007489 CAAGACCCCAGGTCCTGACATGG + Intronic
1116558402 14:46343836-46343858 GAAGAAACACTTTCCTCACATGG + Intergenic
1128553702 15:68615675-68615697 GAAGACACAAGGGCCTCTCAGGG - Intronic
1133981805 16:10638401-10638423 CAAGACAGCCTGTCCTCAAAGGG - Intronic
1134522046 16:14923280-14923302 GGAGGCACACGGGCCTCACAGGG - Intronic
1134709715 16:16321931-16321953 GGAGGCACACGGGCCTCACAGGG - Intergenic
1134716928 16:16361961-16361983 GGAGGCACACGGGCCTCACAGGG - Intergenic
1134949888 16:18346714-18346736 GGAGGCACACGGGCCTCACAGGG + Intergenic
1134957823 16:18390198-18390220 GGAGGCACACGGGCCTCACAGGG + Intergenic
1135807085 16:25552584-25552606 GCAGACAGCTGCTCCTCACATGG - Intergenic
1138878156 16:60978436-60978458 GAATATACCTTGTCCTCACAAGG + Intergenic
1146508613 17:33426699-33426721 GCATACAGCAGGTCCTCACAAGG - Intronic
1152244746 17:79179489-79179511 GAAGACCCTGGGTCCTCTCAGGG + Intronic
1155104983 18:22655061-22655083 AAAGACAAGCTGTCCTCACAGGG - Intergenic
1160512157 18:79458679-79458701 GAAGGCAGCCGGTCCTGAAAGGG - Intronic
1160854801 19:1211952-1211974 GAGGACACCCAGGCCTCACATGG - Intronic
1161264719 19:3358960-3358982 AAAGACACCCAGACCTCAGAGGG - Intergenic
1165220240 19:34310441-34310463 CAAGACAGCCTGTTCTCACAGGG - Intronic
1167671227 19:50854954-50854976 GAAGACAACCGGGACCCACATGG - Exonic
930394023 2:50796978-50797000 GAGGACACTGTGTCCTCACATGG + Intronic
938382105 2:130842461-130842483 TAACACACTCTGTCCTCACAGGG - Intronic
938697494 2:133848015-133848037 GAAGACACCAGCCCCTAACAGGG + Intergenic
943436108 2:187867491-187867513 AAAAACACCTGTTCCTCACAGGG + Intergenic
1172703910 20:36869121-36869143 GAATACACCCGGTGTTCACTGGG - Intergenic
1175759942 20:61555455-61555477 GATGAGACCCTGTCCTCAGAGGG - Intronic
1175767655 20:61602290-61602312 GCAGACACCCGGTCCCCAGTAGG + Intronic
1180474422 22:15689805-15689827 GAAAACACCCGGCCCACCCAAGG - Intergenic
949750158 3:7342945-7342967 GAACTCACTGGGTCCTCACAAGG - Intronic
954812000 3:53254442-53254464 TAAGACACCCTGTTCTCAGAAGG - Intronic
957072719 3:75579324-75579346 CAAGACACCGGGAGCTCACAGGG + Intergenic
959587571 3:108039393-108039415 GAAGACACCTGGCCCAAACAGGG + Intergenic
968589704 4:1451183-1451205 GTCCACACCTGGTCCTCACAAGG - Intergenic
969615142 4:8247713-8247735 GAACACACCCGTTCCCGACAGGG + Intergenic
970722746 4:19007103-19007125 AAGGACACTGGGTCCTCACAAGG - Intergenic
971258086 4:25031459-25031481 GAAGCCAGCCAGTCCTCCCATGG + Intergenic
974511073 4:62841649-62841671 GAAGACACTGTGTCCTCACATGG + Intergenic
984994218 4:185412781-185412803 GAAGACACCTGCTAGTCACAGGG + Intronic
985647220 5:1090668-1090690 GCAGAGACGCGGTCCACACAGGG + Intronic
986287492 5:6370657-6370679 AAAGAAAGCCGGACCTCACAGGG + Intergenic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
993671759 5:90769069-90769091 GAAGACAACCCCTTCTCACATGG - Intronic
1002533033 5:179859873-179859895 GAAAACACCCAATCCTGACAAGG + Intronic
1012357936 6:98339388-98339410 GAAGACACCCGTCCCTCAGCCGG - Intergenic
1017513540 6:155135675-155135697 CAATGCACCTGGTCCTCACAGGG + Intronic
1017525612 6:155239394-155239416 GAAGCCACCCTGCCCTCACTGGG + Intronic
1017986051 6:159444078-159444100 GAAGAGACCCAGTACCCACAGGG - Intergenic
1019277595 7:184074-184096 GAAGCCACGGGGCCCTCACAGGG + Intergenic
1021575080 7:22099268-22099290 GAAGGCACCCCATCTTCACATGG + Intergenic
1022252185 7:28619340-28619362 GCAGACACCTGGATCTCACAGGG + Intronic
1026100188 7:67378165-67378187 GAGGACACCCGGGCTGCACACGG + Intergenic
1029510329 7:100990519-100990541 GAAGACACCTGGTCAGCCCATGG - Intronic
1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG + Intronic
1035863137 8:3052338-3052360 AAAGACACCAAATCCTCACAAGG + Intronic
1042995227 8:74690821-74690843 GAAGACATCCGGTACCCACAAGG + Intronic
1046340129 8:112843347-112843369 GAAGACACTGTGTCCTCACATGG - Intronic
1048034802 8:130667445-130667467 GAAGACCCCCGGTCATCCCAGGG - Intergenic
1048995309 8:139790440-139790462 GACCACAGCCGGTGCTCACAGGG + Intronic
1057791293 9:98126841-98126863 GTGGGCACCCCGTCCTCACATGG - Intronic
1059560919 9:115333723-115333745 GAAGACCCCCAGCTCTCACAGGG - Intronic
1059721264 9:116962261-116962283 GAAGACATAGGGTCCTCACTGGG - Intronic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1185972817 X:4683555-4683577 GAAGAAACGCTGTCCTCAGAAGG + Intergenic
1186478410 X:9877331-9877353 GATGCCACCTGGACCTCACAAGG - Intronic
1187489959 X:19741984-19742006 GATGGAACCTGGTCCTCACACGG + Intronic