ID: 923622206

View in Genome Browser
Species Human (GRCh38)
Location 1:235588273-235588295
Sequence CCTGAGAGGGAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923622206_923622220 28 Left 923622206 1:235588273-235588295 CCCTCCATGGCCTCCCTCTCAGG 0: 1
1: 0
2: 2
3: 59
4: 515
Right 923622220 1:235588324-235588346 ATGTCTGCCACCCACAGCCGAGG 0: 1
1: 1
2: 0
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923622206 Original CRISPR CCTGAGAGGGAGGCCATGGA GGG (reversed) Intronic
900396659 1:2455805-2455827 CCGGGGAGGGAGGCCCTGCAGGG - Intronic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
901063675 1:6485237-6485259 CCTGTGCGGGAGGCCAGGGAGGG - Intronic
901070145 1:6512881-6512903 CCTCACAGGGTGGCCATGGGGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902562573 1:17286908-17286930 CCTGAGAGCCAGGCCCCGGAAGG - Intergenic
902643422 1:17781164-17781186 ACAGAGAGGAAGGCCATGTAAGG - Intronic
902789859 1:18760377-18760399 TCTGAGAGGGAGGCCAGGGGAGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903355725 1:22746263-22746285 TCTGGTAGGGAGGCCAGGGAAGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904325339 1:29724322-29724344 CCCCAGAGGGAGGCCATGAGAGG - Intergenic
904413308 1:30338393-30338415 CCAGAGAGGGTGGCCAAGGCAGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906390221 1:45408746-45408768 CCTGAGAGCCAGGTGATGGAAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906666033 1:47622753-47622775 TCTGGGAGGCAGGCCATGGCTGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906797378 1:48708828-48708850 CCAGACAGGGAGGCCAAGGGAGG - Intronic
907909689 1:58815289-58815311 CCTGTGGGGGAGGCCAGGAAAGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910102806 1:83596833-83596855 CTAAACAGGGAGGCCATGGAAGG - Intergenic
911941288 1:104051251-104051273 CCTGGGAGGGACCCCATGGAAGG - Intergenic
912573259 1:110640393-110640415 CCTGGGAGACAGGACATGGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913271192 1:117095092-117095114 CCTCAGTGGGAAGCTATGGAAGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915492468 1:156258848-156258870 GCTGGGAGGGAGGCCTGGGAAGG - Intronic
916535784 1:165701783-165701805 CCTGAGGGAGAGGCCAGTGAAGG - Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917450036 1:175140413-175140435 CCTGACCAGGAGGCCAGGGAGGG - Intronic
917707165 1:177646284-177646306 CTGGAGAGGGAGGTCATAGAGGG + Intergenic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
917979450 1:180259993-180260015 ATTGAGAGGGAGGGCCTGGAAGG + Intronic
918097318 1:181345987-181346009 TCTGAGGGGCAGGCCATAGATGG + Intergenic
919129377 1:193434056-193434078 CCTGAGAGGGACCCAATGGGAGG - Intergenic
919834738 1:201565923-201565945 TCTGAGAGGGAGGCGCTGAAGGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920991644 1:210945542-210945564 CCTGAGGGGAAGCCCTTGGAAGG - Intronic
921416264 1:214890837-214890859 CCTGAGAAGGTGGGCATGGTAGG + Intergenic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
922351874 1:224740876-224740898 CCAGAGAGGCAAGCCTTGGATGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922654058 1:227365411-227365433 CCTGAGAGTGAGTTTATGGAGGG + Intergenic
922740286 1:228010580-228010602 CCTGAGAGGGAGAGCAGGGCTGG - Intronic
922797909 1:228350225-228350247 GCTGAGAGTGATGCCAGGGAAGG - Intronic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
923049227 1:230379064-230379086 CATGTGAGTGAGGCCATGGTTGG - Intronic
923246390 1:232136658-232136680 CCTGGGATGGAGGCGAGGGAGGG + Intergenic
923503126 1:234582781-234582803 CCGGTGAGGGAGGACAGGGAGGG - Intergenic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
924385186 1:243493179-243493201 CTTGAGAGGCAGGCCCTGGCTGG + Intronic
924941044 1:248812618-248812640 CCTGAGAGGAAGGCTCTGGAAGG - Intronic
1062958660 10:1557097-1557119 CCTGAAACTGAGGCAATGGAAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063365708 10:5488998-5489020 CGTGAGAGGGAAGCCAGGGGAGG + Intergenic
1063677048 10:8150074-8150096 CCTCAGAAGGTGGCCAGGGAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065981434 10:30902127-30902149 CCTGAGAGGGTTGCCATGGCTGG + Intronic
1065993019 10:31031559-31031581 CCTGGGAGCGAGGCCTTAGAAGG - Intronic
1067655334 10:48187445-48187467 CCTCAGAGGGACCCCATCGAGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069858218 10:71453433-71453455 GCTGAATGGGAGGCCAGGGAGGG + Intronic
1070300211 10:75198135-75198157 CCAGTGTGGGAGGCAATGGAAGG - Intergenic
1071052902 10:81473256-81473278 CATGGGACGGAGGCCAAGGAGGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1073310212 10:102534936-102534958 ACTTAGAGGGAGGCCACTGAAGG + Intronic
1076484042 10:130804441-130804463 CCCGACAGTGAGGCCAGGGAGGG + Intergenic
1076511689 10:131018765-131018787 TCTGAGACTGAGGCTATGGATGG - Intergenic
1076737342 10:132464766-132464788 TCTGAGAGAGAGGCCAGGGAGGG - Intergenic
1076752609 10:132551155-132551177 CCTGAAAGGTAGGCAAGGGAGGG - Intronic
1076895631 10:133309960-133309982 TCTGAGAGGCAGGACATGGTGGG + Exonic
1077150419 11:1070586-1070608 GCTGTGAGGGTGGCCATGGGGGG + Intergenic
1077305833 11:1868365-1868387 CCCGAGATGGAGGGAATGGAGGG - Intronic
1078161154 11:8840651-8840673 CTTGAGAGGGATGCTGTGGATGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080248171 11:30203138-30203160 CCTGGGAGGGAGGTGATGGTAGG + Intergenic
1080660541 11:34292728-34292750 CCTCATAGGGAGGTCAGGGAGGG + Intronic
1080985273 11:37455751-37455773 CCTCAGAGAGAGGCCATGTGTGG + Intergenic
1081751040 11:45511575-45511597 ACTGAGAGGGAGGCCAGTGTGGG - Intergenic
1081845065 11:46234709-46234731 CCAGACAGGGAGGCCCAGGAAGG - Intergenic
1083850378 11:65362568-65362590 CAAGTGAGGGAGGCCAAGGAGGG + Intergenic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084433462 11:69124038-69124060 CCTGAGGTGGAGGCCCTGGGAGG - Intergenic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1084751376 11:71206196-71206218 CCGGAGAGGGAAGCAATGGGAGG - Intronic
1085386438 11:76160821-76160843 CCTGGGAGGGAGGACAAGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086001549 11:81990894-81990916 GCTGAGAGGGAGCCCACGGCTGG + Intergenic
1086820714 11:91433240-91433262 CCTGAGACAGAGACCATGGTGGG - Intergenic
1086894198 11:92293224-92293246 AATGAAGGGGAGGCCATGGAGGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088952809 11:114588168-114588190 CCAGAGAGGGAGGACAAGAAGGG - Intronic
1089190231 11:116648405-116648427 CTTGAGAGGGAGGACCTGGGAGG - Intergenic
1089737478 11:120559900-120559922 CCTGAGAGGGAGGCCTGAGAGGG + Intronic
1090203752 11:124873740-124873762 GCTGAGAGGGAGCCCCCGGAGGG - Exonic
1090363165 11:126187122-126187144 CCTGTGTGGGAGGGCAAGGAGGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091647975 12:2288229-2288251 CTGGAGAGGGAGGCCAGGGAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097180832 12:57170981-57171003 CCTGAGAGGGAGGACAGAGAAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101826146 12:108221539-108221561 GCTGAGAGGGATGCCCTGTAAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1103240555 12:119409800-119409822 ACAGAGAGGGGGGCCTTGGAGGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103617717 12:122165309-122165331 CCAGGGACGGAGGCCAGGGAAGG + Intergenic
1103989122 12:124786487-124786509 CCTCAGAGCGGGGCCATGGAGGG - Exonic
1104089887 12:125507529-125507551 CCTGAAGGCGAGGCCAAGGATGG + Intronic
1104678192 12:130729837-130729859 CCTGGGAAGGTGGCCGTGGAGGG + Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104929918 12:132333267-132333289 TCTCTGAGGGAGGCCCTGGAAGG - Intergenic
1104939538 12:132388434-132388456 TCAGAGAGGGAGGCCATGGTAGG + Intergenic
1105206789 13:18232467-18232489 CCTGTCAGCGAGGCCCTGGATGG - Intergenic
1105207236 13:18234576-18234598 CCTGTCAGCGAGGCCCTGGACGG - Intergenic
1105728319 13:23187105-23187127 GCAGGGAGGGAGGCCATGCATGG - Intronic
1106562754 13:30860812-30860834 CTTGTCAGGGAGGCCAAGGAAGG + Intergenic
1108082385 13:46749970-46749992 CTTGAAAGGGAGGCTATTGAGGG + Intronic
1108455714 13:50611820-50611842 TGTGACAGGGAGCCCATGGAAGG - Intronic
1109124587 13:58503812-58503834 CCTGAGAGGGTTGCCATTGCTGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112044926 13:95587193-95587215 CCTGTGAGGGCTGCCAGGGAGGG - Intronic
1112045307 13:95590712-95590734 CCAGGGAGGGAGGCCATCGAAGG + Intronic
1112777935 13:102865825-102865847 TCTGAGAGGGACGACGTGGATGG + Exonic
1113616571 13:111684803-111684825 CCTCAGAATGAGGCCACGGAAGG + Intergenic
1113622101 13:111770074-111770096 CCTCAGAATGAGGCCACGGAAGG + Intergenic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1113964792 13:114146756-114146778 TCTGCGAGGGAGCCCCTGGAGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117452638 14:55865811-55865833 CCTGAGAGGGAGCTCCCGGAGGG - Intergenic
1119054708 14:71407510-71407532 CCTGGGAGGGAGGGAAAGGAGGG - Intronic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1120854861 14:89203524-89203546 TCTGGGAAGGAGGGCATGGAGGG + Intronic
1121011450 14:90522539-90522561 CCTGAGTGGAAGGACATGTAGGG + Intergenic
1121722422 14:96119103-96119125 CCAGTGAGGGAGCCCCTGGAAGG - Intergenic
1121996404 14:98606865-98606887 GCTGGCAGGGAGGCCAGGGAAGG + Intergenic
1122142959 14:99673633-99673655 ACTGAGGGGGATGGCATGGAGGG + Intronic
1122372691 14:101237367-101237389 CCTGGGAAGGAGGCCAGGGGAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122690005 14:103527800-103527822 AGAGAGTGGGAGGCCATGGAAGG + Intergenic
1122788849 14:104176059-104176081 CCTGAGGGGGGGCCCCTGGAGGG + Exonic
1123100627 14:105796590-105796612 TCTGTGAAAGAGGCCATGGATGG + Intergenic
1123179237 14:106452962-106452984 GGTGAGAGGGAGGACATGAAAGG + Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125927301 15:43573337-43573359 CCTGTGAGGGAGGGCTGGGAGGG - Exonic
1125940444 15:43672902-43672924 CCTGTGAGGGAGGGCTGGGAGGG - Intergenic
1126152561 15:45536358-45536380 CCTGTGAAGGGGGCCATGCAGGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126404913 15:48313824-48313846 TCAGAGAGGGAAGCCAGGGAAGG - Intergenic
1126824939 15:52539642-52539664 CATGAGAGGGACCCCATGGGAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128154921 15:65386045-65386067 CCTGGGAGGGATTCCCTGGAAGG + Exonic
1128326366 15:66726486-66726508 ACTGAGAGGGAAGCCGAGGAGGG + Intronic
1128764626 15:70243605-70243627 TCTGGGAGGGAGGCCTGGGAAGG + Intergenic
1129117777 15:73374850-73374872 CCAGAGAGGGAGGCACTGGGAGG + Intergenic
1129185828 15:73905882-73905904 CCTGGGACAGAGGCCAGGGAAGG - Intergenic
1129566197 15:76625668-76625690 CCAGAGAGGGAGTCCATGCTTGG - Intronic
1129694606 15:77733491-77733513 CCTGAGAGGAGGGCTATGGTTGG - Intronic
1129818132 15:78574132-78574154 CCTCAGGGGGAGGCCAAGGCGGG + Intronic
1129848097 15:78777273-78777295 CCTGTGGGAGAGGCCAGGGATGG - Intronic
1130253820 15:82316663-82316685 CCTGTGGGAGAGGCCAGGGATGG + Intergenic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1131921307 15:97331751-97331773 CATGGGAGGGAGTCAATGGAGGG + Intergenic
1133210939 16:4263195-4263217 CCTGTGAGGAAAGCCAGGGAGGG - Intronic
1134015854 16:10887783-10887805 CATGAGAAGGAGGCCAGGGGTGG - Intronic
1134038861 16:11052618-11052640 CCTGGCAGGGAGGACATGGAAGG - Intronic
1134421486 16:14095110-14095132 CCTGAAAGGCAGTGCATGGAAGG + Intronic
1134863215 16:17579501-17579523 CCAGGAAGGGAGACCATGGAGGG + Intergenic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1135354384 16:21757320-21757342 CCTGACAGGGAGGACAAGGAAGG - Intronic
1135415497 16:22265506-22265528 CCTGTGGTGGAGGCCAGGGAAGG - Intronic
1135424011 16:22323424-22323446 CTTGGGAGGGAGGCCATGGGTGG - Intronic
1135452875 16:22573460-22573482 CCTGACAGGGAGGACAAGGAAGG - Intergenic
1136536707 16:30903833-30903855 CCAGAGAGACAGGCCAAGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137756230 16:50904593-50904615 CTTGTCAGGGAGGCTATGGAGGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138354588 16:56367140-56367162 CCTGAGTGAGAGCCCGTGGAAGG - Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139949144 16:70660810-70660832 AATGAGAGGGATGCCAGGGATGG + Intergenic
1140334731 16:74094740-74094762 CCTGAGTGGGAGGGCAGGGCAGG - Intergenic
1140661341 16:77193429-77193451 CCTGAAAGGGAGCCCCTGGTGGG - Exonic
1141616830 16:85214658-85214680 CCAGAGAGGGAGGCCTCAGAAGG - Intergenic
1141761834 16:86033619-86033641 AACGAGAGGAAGGCCATGGATGG - Intergenic
1141827691 16:86492787-86492809 TCTGAGAGGGAGGCACTGGGTGG - Intergenic
1142192627 16:88724971-88724993 CCTGAGAGGGTGGCCACAGGCGG + Intronic
1142514068 17:415561-415583 TCTGAGAGGGACAGCATGGAGGG + Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142708258 17:1709832-1709854 CCAGCGCGGGTGGCCATGGATGG + Exonic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1143039597 17:4023982-4024004 ACTGATAGGGAGGTCATGGAGGG - Intronic
1143110508 17:4550213-4550235 CGTGACAGGGAGGCCTTGGTTGG + Exonic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1144862652 17:18315201-18315223 CATGAGAAAGAGGCCTTGGATGG - Intergenic
1145784047 17:27582711-27582733 GCTGAGAGGGTGTCCGTGGAAGG - Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146673435 17:34757289-34757311 CTTGAAAGGGAGGTCAGGGATGG + Intergenic
1146688121 17:34855450-34855472 TCAGAGAGGGAGGGCAGGGAAGG - Intergenic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1146943590 17:36859910-36859932 GGGGAGAGGGAGGCCAGGGAAGG + Intergenic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147623308 17:41882767-41882789 GATGAAAGGGAGGCCAAGGAGGG - Intronic
1147689400 17:42306219-42306241 CCTGAGAGGGAGACAAGAGAGGG - Exonic
1147771620 17:42872146-42872168 CCTCAGAGGGAGGACATTGGTGG + Intergenic
1148082847 17:44976975-44976997 CCTCTGAGGGTGGACATGGAGGG + Intergenic
1148244768 17:46023486-46023508 CCTGGGAGGCAGGTCAGGGAAGG + Intronic
1148857436 17:50586440-50586462 CCTGGGAGGATGTCCATGGAGGG - Intronic
1148895275 17:50835861-50835883 CCTGAGAAGAAGGCCCTGGTGGG + Exonic
1149347172 17:55750923-55750945 CCTGAGGGTGGGGCCCTGGAGGG - Intergenic
1149480873 17:57002218-57002240 CCTGAGAGGGAAGCCACAGGCGG + Intronic
1150457507 17:65319047-65319069 CCTTAGAAGGAAGCCATGGCAGG + Intergenic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1151356186 17:73559967-73559989 CCTGGGAGGGATGGCATGAAGGG + Intronic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152285722 17:79411557-79411579 GCACAGAGGGAGGGCATGGAAGG - Intronic
1152813260 17:82392154-82392176 CCTGAGGTGGAGGCCAGGAAAGG - Exonic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1155661179 18:28250133-28250155 CCTGTGACGCAGGCCATAGAGGG - Intergenic
1155670187 18:28361305-28361327 CCTGAGAGGACCGCCTTGGAAGG - Intergenic
1156468507 18:37362795-37362817 GATGTGAGGGAGGCCCTGGAAGG - Intronic
1156839576 18:41595221-41595243 CCTGTGAGGGCGGGCATAGAAGG + Intergenic
1158390520 18:57041140-57041162 TGTGACAGGGAGGCCAGGGATGG + Intergenic
1159059188 18:63496923-63496945 TCTTAAAGGGAGCCCATGGAAGG - Intronic
1160043598 18:75367476-75367498 GCTGGGAGGGAGGCCTGGGATGG - Intergenic
1160171504 18:76559176-76559198 CAGGAGAGAGATGCCATGGATGG + Intergenic
1160586814 18:79917714-79917736 CCCGAGAGGGTGTCCATGGCTGG - Intronic
1162142869 19:8595319-8595341 CCAGACAGGGAGTCCCTGGAAGG + Intronic
1162156499 19:8681605-8681627 CTGGGGAGGAAGGCCATGGAGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162737028 19:12752376-12752398 CCTGAGATGAAGGTCAGGGAGGG + Intronic
1163235706 19:16029262-16029284 TCTGAGAGGGAGGCCTTCAAAGG - Intergenic
1163536799 19:17881626-17881648 CCTGAGTGTGTGGCCTTGGAAGG - Intronic
1163613327 19:18312011-18312033 ACTGAGGAGGAGGCCAGGGATGG - Intronic
1164828049 19:31298691-31298713 CATGACATGGAGCCCATGGACGG - Intronic
1165941046 19:39415003-39415025 CCTCGGGGGGAGGCCATGGTGGG - Exonic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166390533 19:42406711-42406733 CCTCAGAGGGCGGGAATGGAAGG + Intronic
1166658461 19:44629162-44629184 AGTGAGATGGAAGCCATGGAGGG + Intronic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168097933 19:54126000-54126022 CCTGTAAGGGAGGCCAGGGCTGG + Intronic
1168350087 19:55670685-55670707 GCTGAGTGGCAGGCCTTGGAGGG + Intronic
1168368500 19:55810885-55810907 CATGAGAGGGAAGCCCTTGAAGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925804075 2:7631259-7631281 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804089 2:7631327-7631349 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804112 2:7631427-7631449 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804119 2:7631461-7631483 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804127 2:7631495-7631517 CCTAAGAGGCTGGGCATGGATGG - Intergenic
926709810 2:15869933-15869955 CGGGAGATGGAGGCCATGGTGGG - Intergenic
926822940 2:16873005-16873027 CCTGGGAGTTAGTCCATGGAGGG + Intergenic
927038468 2:19204516-19204538 CCTGAGAAGGAGGCCAACAAGGG + Intergenic
927250249 2:20990114-20990136 CCTGGGAGGCAGGCCATGGCAGG + Intergenic
927696822 2:25244861-25244883 CCTGAGAACAAGGCCAGGGAGGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928883964 2:36127712-36127734 CCAGAGAGGCAGGCAAGGGAAGG + Intergenic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929187637 2:39111974-39111996 CCAGAGATAGAGGCCAAGGAGGG - Intronic
929469261 2:42175061-42175083 CCTGTAAGGGAGGCCAAGGTGGG - Intronic
929702800 2:44179026-44179048 TCTGAGAGGGACCCCATGGGAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
932605981 2:73166041-73166063 CCTGAGAGGGAAGGTAAGGAGGG - Intergenic
932706103 2:74026184-74026206 CCTGGGATGGAGGCCATCGCTGG + Intronic
933051037 2:77602748-77602770 GCTGAGAGGGATGACATAGAAGG - Intergenic
933833992 2:86231398-86231420 GCTGAGAGGGAGGAAATGGACGG + Intronic
933926444 2:87094409-87094431 CCTGAGAGGGAAGGTAAGGAGGG + Intergenic
935250358 2:101255085-101255107 CCAGAGAAGGAATCCATGGATGG + Intronic
935552146 2:104468968-104468990 CCTGAGAGGGAAGTTATGTATGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936063979 2:109316807-109316829 CCAGAGGGTGAGGCCAGGGAGGG - Intronic
936117728 2:109715380-109715402 CCTGAAAAGGAGGCCAGGCATGG - Intergenic
937266199 2:120616060-120616082 CCTGAGAAGGGGACCCTGGAGGG - Intergenic
937418923 2:121738702-121738724 CCTGAGGTGGAGGCCCTGGGAGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941151369 2:161919188-161919210 CATGAGATGGAGGCCAAGGTGGG + Intronic
941346031 2:164370833-164370855 CATGGGAGGGACCCCATGGAAGG + Intergenic
941462961 2:165793655-165793677 CCTGAGAGGGAGGGCCCGGCGGG - Intronic
941468334 2:165856115-165856137 CCTTAAAGGGAGGCCATGGGAGG + Intergenic
941597665 2:167497797-167497819 CCTTAGAGAGAGGCCATTGATGG + Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
942455682 2:176136766-176136788 CCGGCGAGGGAGGGCCTGGAAGG + Intergenic
942663575 2:178291878-178291900 TCTCAGAGGTAGGCAATGGAAGG + Intronic
942760750 2:179394673-179394695 ACTGAGAGTAAGGTCATGGAAGG + Intergenic
942877994 2:180825846-180825868 CCTGAGCTGGAAGCCATGTATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944304665 2:198165702-198165724 CCTGAGAAAGATGCCATGGGAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946063691 2:216968079-216968101 CTTGAGTGAGAGGCCATGGGAGG + Intergenic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
947171950 2:227320908-227320930 GCTGTGAGGGAGCCCATGGTGGG - Intergenic
947591885 2:231390558-231390580 CCAGAGAGAGAGGCTGTGGAGGG + Intergenic
947632892 2:231665332-231665354 TCTGCGGGGGAGGCCATGGTGGG + Intergenic
947969197 2:234307836-234307858 CCTGAGAAGCAGGCAATGAAAGG - Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948880470 2:240854733-240854755 CCTGAGATGCAGGCCAGGGTGGG + Intergenic
948899781 2:240950421-240950443 GCTGAGAGGGAGGCTCTGAAGGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169355089 20:4898985-4899007 CTTGGGAGTGAGGCCAGGGAAGG + Intronic
1172389302 20:34555815-34555837 CTTGGGAGGGGGGCCATGGCAGG - Intronic
1172577395 20:36019705-36019727 GCTGAGATGGAGGGCTTGGAAGG + Intronic
1173176777 20:40770909-40770931 CCTGAGAGTGAGGGAAGGGAAGG - Intergenic
1173500297 20:43548274-43548296 CTGGAGAGGGAGGCCAAGCAGGG - Intronic
1173904403 20:46615418-46615440 TCTTACAGGGAGGCCAGGGAGGG + Intronic
1174525366 20:51166171-51166193 AGTGAGAGGGAGGCTCTGGATGG + Intergenic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175278188 20:57786106-57786128 CCAGAAAGGGAGTCCAAGGAGGG - Intergenic
1175466291 20:59192790-59192812 GCTGCGCGGGAGGCCATGGCCGG + Exonic
1175814077 20:61874527-61874549 CCCCAGAGGGAGGCCCTGGGCGG + Intronic
1175916590 20:62428714-62428736 CCTGAGTGGGAGGGCATCGTGGG - Intergenic
1179025272 21:37674411-37674433 TCTGAGAGGGGAGCCCTGGAGGG - Intronic
1179914466 21:44467417-44467439 CCGGGGAGGCAGGCAATGGAGGG - Intergenic
1180025830 21:45161534-45161556 CATGAGAGGGAGGCCAACGCGGG + Intronic
1180036421 21:45252626-45252648 AGTGTGAGGGAGGCCATGGCGGG - Intergenic
1180069005 21:45426821-45426843 TCTGGGAGGGAGGCCTTGGAGGG + Intronic
1180087221 21:45513183-45513205 CATGAGATGGGGGCCCTGGATGG - Exonic
1180799344 22:18624527-18624549 CCAGAGAGGCAGGACACGGACGG + Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181105500 22:20572382-20572404 CTTGAGAGACAGGGCATGGAGGG - Intronic
1181222374 22:21370739-21370761 CCAGAGAGGCAGGACACGGACGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182276924 22:29195665-29195687 CAGGAAAGGGAGGCCAGGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182968023 22:34541313-34541335 CATGAGAGGGACCCCATGGGAGG - Intergenic
1183361445 22:37385141-37385163 CCTGAGAGGTAGCCCGGGGAGGG + Intronic
1183395547 22:37568953-37568975 CATGGGAGGGAGGACAGGGAAGG + Exonic
1183538588 22:38417062-38417084 CCCGAGAGGGAGGTCATGGTTGG + Intergenic
1183640194 22:39088100-39088122 CTAGAGAGGGAGCCCAGGGAAGG + Intergenic
1183649127 22:39144360-39144382 CCTGGGAGGGATGTCAGGGAAGG - Intronic
1183964406 22:41432808-41432830 TTTGAGAGGGAGGCCAAGGTGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184756717 22:46520248-46520270 GCTCAGAAGGAGGCCCTGGATGG + Intronic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
1185373347 22:50470842-50470864 CTGGAAAGGCAGGCCATGGAGGG + Intronic
950283753 3:11728716-11728738 CCTGACAGGGAGGCCAGGCACGG + Intergenic
950293467 3:11807045-11807067 CCTGAGAAGGGGAACATGGAAGG - Intronic
950467157 3:13162308-13162330 CCAGAGAGGCAGGCCAGGGAGGG + Intergenic
951961337 3:28325391-28325413 CCTGGGAGGGTGGATATGGATGG + Intronic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
953931893 3:47009744-47009766 CCTGGGACGGTGGCCATGGCAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954424152 3:50434556-50434578 CCTCTGAGAGAGGGCATGGAAGG + Intronic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
957389021 3:79537565-79537587 CCTCAGAGAGAAGCCATGGGTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960277210 3:115742073-115742095 CCTGGGATGGAGGCCCTGCAGGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961314208 3:126023405-126023427 CCTGTGAGGGAAGACAGGGAGGG + Intronic
963327233 3:143876251-143876273 CCAGAAAGGGAGCCCATAGAGGG - Intergenic
963801417 3:149679699-149679721 CCTGAGAGGGAGCCAAAGGTTGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964376391 3:156052255-156052277 GCTGTGTGGGAGCCCATGGAGGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968353188 3:198080228-198080250 CCTGGGACGGGGGCCTTGGAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968573548 4:1354655-1354677 CCGGAGAGGCAGACCATGCAAGG - Intronic
968919619 4:3515734-3515756 CCTGAGATGGAGGCCCAGGGAGG - Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
969317871 4:6392952-6392974 CCTGAGAGAGAAGCCATATAAGG - Intronic
969637061 4:8375385-8375407 GCTGAGACTGAGGCCTTGGAGGG - Intronic
969670643 4:8588230-8588252 CCAGAGAGGGTGGCCTGGGATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970440539 4:16077712-16077734 CCTGAGAGGGAGGGCACTGAAGG - Intronic
970451273 4:16168602-16168624 CCTTAGAGGGTGGCCAGGGCAGG - Intronic
971024181 4:22571717-22571739 CCTGAGAGGGAGCTCATGCTGGG - Intergenic
971096386 4:23409316-23409338 CCTCAGACAGTGGCCATGGATGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
975242049 4:72071607-72071629 GCTGAGAGGTAGGGGATGGATGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977133937 4:93278120-93278142 CCAGAATGGGAGGCAATGGATGG + Intronic
977506711 4:97911690-97911712 CCTGGGAGGGAGCCCCTGGTGGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978611293 4:110543819-110543841 CCAGAGAAAGAGGCCATGGGAGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982856270 4:160385883-160385905 CGTGAGAGGAAGGCCAAGGAGGG - Intergenic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985677057 5:1237603-1237625 TGGGAGAGGGAGGCCAGGGAGGG + Intronic
985751603 5:1681837-1681859 CCTGAGAGGAAGTTCATGCAGGG - Intergenic
986048409 5:4063655-4063677 AGTGTGAGGGAAGCCATGGATGG + Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
987573272 5:19693604-19693626 CATGAGAGGAAGGCCAAGCATGG + Intronic
988213723 5:28243989-28244011 ACAGTGAGGGAGGCCATGTAAGG - Intergenic
988318988 5:29668810-29668832 CCTGGGAGGGACCCCATGGGAGG + Intergenic
988510100 5:31857438-31857460 CCTGAGAAAGAGGACATGGGAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990406671 5:55497961-55497983 CCTGAGACTGAGGGCAGGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991399021 5:66234526-66234548 CTTGAGCGGGAGCTCATGGAAGG + Intergenic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
991619895 5:68534439-68534461 CCTGGGCTGGAGGCCATGGGTGG - Intergenic
992385016 5:76276408-76276430 CCTGAGAGGGAGTCCTGGAAAGG - Intronic
993420998 5:87700840-87700862 CCTGAGATGGAGCCCATGGCAGG - Intergenic
994146671 5:96402820-96402842 ACTGACAGAGAGGCCTTGGAAGG + Intronic
995118438 5:108508301-108508323 CATGACGGGGAGGCCAAGGAGGG + Intergenic
995369915 5:111407728-111407750 CCTCTGAGGGAGGCCATTGTGGG - Intronic
995530888 5:113090993-113091015 CGTGGGAGGGAGGAGATGGAGGG + Intronic
996638768 5:125728302-125728324 CCAGAGAGGGTGGTCAAGGAAGG + Intergenic
999063985 5:148665363-148665385 TCTGAGAGTGTGGCCGTGGAAGG - Intronic
999244218 5:150144749-150144771 CCTGAGAAGGAGGTCAGTGAGGG + Intronic
999247047 5:150160609-150160631 GCTGAGAGGGAGGCCAGCAAGGG - Intergenic
999251392 5:150184294-150184316 ATTGAGAGGGAGGCCCTGGGAGG + Exonic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1001571865 5:172735403-172735425 CCTGAGGGGTGGGCCCTGGAGGG + Intergenic
1001924354 5:175625557-175625579 CCTGTGACGGAGGCCATGTGTGG + Intergenic
1003700779 6:8462580-8462602 CCTCAGGGAGAGGCCATGGTTGG + Intergenic
1004280590 6:14276400-14276422 CCAGAGAGGGAGCCCAAAGAAGG + Intergenic
1005354091 6:24965840-24965862 ACTGAGATGGAGCACATGGAAGG - Intronic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1006854688 6:37124644-37124666 ACTGAGAGGGAGGCCCAGCAAGG - Intergenic
1006934228 6:37706013-37706035 CCTGGGATGGTGGGCATGGAGGG - Intergenic
1007125917 6:39425487-39425509 CGGGAGAGGGAGGCCATAGTGGG - Intronic
1007654454 6:43443925-43443947 TCTCAGAGGGAGGTCCTGGAGGG - Exonic
1007725130 6:43911487-43911509 GCTGGGAGGAAGGCCAAGGAGGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009584858 6:65587355-65587377 CGTGAGAGGGACCCCATGGGAGG + Intronic
1011447638 6:87459346-87459368 TCTGACAGAGAGGTCATGGAGGG - Intronic
1013793240 6:113858667-113858689 CCCGAGAGGTCGGCCATGGGTGG + Intronic
1015718686 6:136217993-136218015 CCTCCAAGGGAGGCCATGGCAGG + Intergenic
1016730967 6:147427212-147427234 CCAGAGAGGGATGGCATGGATGG - Intergenic
1016739750 6:147514335-147514357 CCAGTGAGGGAGGAGATGGAAGG + Intronic
1017522399 6:155213754-155213776 CATGGGAGGCAGGCCAAGGAGGG - Intronic
1017784313 6:157742222-157742244 TCTGAGAGTGAGGGCATGTAAGG + Intronic
1017891433 6:158643031-158643053 CCTGGGATGGAGGCCCTGGGAGG - Intronic
1019157504 6:170049198-170049220 TCTGAGAACGAGGCCATGGACGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019518150 7:1448553-1448575 CCTGGGAGCCAGGCCAAGGATGG + Intronic
1019543227 7:1560712-1560734 CCTGAGGGGGGGGCCAAGGCGGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019892212 7:3955616-3955638 CCTGAGAGGGGCGACCTGGAAGG + Intronic
1019939566 7:4278506-4278528 CCCTAGAGGCAGGCCATGAACGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022176234 7:27874379-27874401 CCTGAGGGGGTGGCAAAGGAGGG - Intronic
1024629822 7:51237987-51238009 CCTGAGGGGCATGCCCTGGAGGG - Intronic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024930466 7:54663190-54663212 CCGAACAGGGAGGCTATGGACGG - Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026676977 7:72436228-72436250 CCTGGGAGGGACCCCATGGGAGG + Intronic
1027661680 7:80995555-80995577 CCTGAGAAAGAGGCTATGGAAGG + Intergenic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029482353 7:100820884-100820906 CCTGAGAAGGAGGCCAAAGAGGG + Intronic
1029657569 7:101937057-101937079 ACACAGAGGGAGGCCATGGGAGG - Intronic
1030641571 7:112012030-112012052 CCTGTGAGGTAGGCCAGGCAGGG - Intronic
1030810335 7:113964096-113964118 CCTTATAGGGAGTCCATGCATGG - Intronic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032188775 7:129750601-129750623 CAGGAGAGGGAGGCCATGATGGG - Intronic
1032297244 7:130650774-130650796 CCTGGGAAGGAAGCCAGGGAAGG - Intronic
1032986538 7:137343699-137343721 CCTGACAGGGAGGGAACGGAAGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034218156 7:149423214-149423236 CCTGATAAGGAGTCCAGGGACGG - Intergenic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034781391 7:153886075-153886097 CCTGAGGGGAAGGGCATGGCGGG - Intergenic
1034950364 7:155292587-155292609 CCTGAGTGGGAGGCTAAGGAGGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035176317 7:157054601-157054623 CCTGAGAGGGAAGACGTCGAAGG - Intergenic
1035616160 8:1003283-1003305 CCTGATAGTGAGGCCATAGCGGG - Intergenic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1036403234 8:8429706-8429728 CTTGAGAGACAGGCCATGGGAGG - Intergenic
1037919843 8:22798052-22798074 GCTAAGAGGGAGGCCAGAGAAGG + Intronic
1037945464 8:22987005-22987027 CCTGAGCTAGAGGCCATGGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038616154 8:29096964-29096986 CCAGAATGGGAGGCAATGGAAGG + Intronic
1038732173 8:30137472-30137494 CCTGAGAGGGAGGGCAAAGCAGG - Exonic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038758396 8:30363199-30363221 CCAAGGAGGGAGGCCAAGGAGGG + Intergenic
1039879753 8:41617671-41617693 CCTGAGAAGGAGCCCAGGGCAGG - Intronic
1039885448 8:41651574-41651596 TCTGATAGGGAGGTCACGGAAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040582492 8:48708842-48708864 CCTGGGAGAGAGGGCAAGGAGGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041552386 8:59117932-59117954 CCAGAGAGGGAGGACACGCAGGG - Intronic
1041871325 8:62637783-62637805 CATGAGAGTGAGGCCAACGAGGG + Intronic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1042824152 8:72963297-72963319 CCTGGCAGGGAGGCCAAGGTGGG + Intergenic
1044467501 8:92525006-92525028 TCTGAAAGGGAGGCAATGAAAGG + Intergenic
1044663281 8:94612176-94612198 CCTGAAAGGGTAGCCAAGGAAGG + Intergenic
1044965364 8:97568983-97569005 ACTGAGATGGAAGCCATGGAGGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048307466 8:133294395-133294417 CCTGGAAGGAAGGCCAGGGAGGG - Intronic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1048553705 8:135456492-135456514 CCTGAGAGGCTGTCCAGGGAAGG + Intergenic
1048678870 8:136815952-136815974 CCTGTTAGGGTGGCCAGGGAAGG + Intergenic
1048993875 8:139777061-139777083 TCAGAGCAGGAGGCCATGGAAGG - Intronic
1049418739 8:142507472-142507494 GCTGAGGGTCAGGCCATGGAAGG - Intronic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049714630 8:144084059-144084081 CCTGAGAGGGGGACCAGGGCAGG - Intronic
1049811943 8:144579576-144579598 GATGAAAGGGAGGCCAGGGATGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1055343309 9:75308611-75308633 CCTGGGATGGAGCCCCTGGAGGG - Intergenic
1056423971 9:86457724-86457746 CCTGGGATGTAGGCCAGGGAGGG + Intergenic
1056540604 9:87567780-87567802 CTTGGGAGGGACGCCATGGAGGG - Intronic
1056737837 9:89224990-89225012 CTTGAGAATGAGGCCAAGGAAGG - Intergenic
1056822243 9:89851445-89851467 CAAGAGAGGGTGGCCATGGGGGG + Intergenic
1057129098 9:92640948-92640970 CCGGGGAGGGAGCCCATGGTGGG - Intronic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1059339294 9:113588381-113588403 TCGGAGAGGGCAGCCATGGATGG + Intronic
1059687536 9:116651730-116651752 CCTGAGAGGTAGGTGATGAAGGG + Exonic
1059796628 9:117704509-117704531 CAGGAGAGGAAGGCCATGGCTGG - Exonic
1060775794 9:126373291-126373313 CCTGTTAGGGAGTCCACGGATGG + Intronic
1060921546 9:127423981-127424003 CCTGAGTGGAAGGCCAACGAGGG + Intergenic
1061748214 9:132755487-132755509 CCTGGGAGAGGGACCATGGAGGG + Intronic
1062016967 9:134295878-134295900 ACTGGGAGGCAGGCCATGGTCGG - Intergenic
1062196292 9:135276054-135276076 CTTGTTAGGGAGGCCAGGGAGGG - Intergenic
1062412410 9:136431794-136431816 CCTGGGGGGGCGGGCATGGAGGG - Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1187447373 X:19371666-19371688 CCTGACAGGAAGGTTATGGAGGG - Intronic
1187798127 X:23027121-23027143 GTTGAGAGGGTGGCCAGGGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190331656 X:49239630-49239652 CCTGAGAGCGAAGGGATGGATGG - Intronic
1190335484 X:49259224-49259246 CCTGAGATGGGGGACATGGCGGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192543338 X:71993356-71993378 ACTGAGATGGGAGCCATGGAGGG + Intergenic
1194665649 X:96674764-96674786 CCAGAGAGGGAGGACCTGGAAGG - Intergenic
1197767744 X:130069983-130070005 ACTGAGAGTGAGGGGATGGATGG + Intronic
1199656524 X:150000413-150000435 CCTGGCAGGGAAGCCATAGAGGG + Intergenic
1202161253 Y:21939136-21939158 CCTGAGTGGGAAGCCATGCCCGG + Intergenic
1202230103 Y:22647237-22647259 CCTGAGTGGGAAGCCATGCCCGG - Intergenic
1202313053 Y:23548928-23548950 CCTGAGTGGGAAGCCATGCCCGG + Intergenic
1202557749 Y:26121666-26121688 CCTGAGTGGGAAGCCATGCCCGG - Intergenic