ID: 923623020

View in Genome Browser
Species Human (GRCh38)
Location 1:235593295-235593317
Sequence GTAAATACAAAGTTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923623012_923623020 30 Left 923623012 1:235593242-235593264 CCGACCATGCTCTGTAAAATTCT 0: 1
1: 1
2: 2
3: 19
4: 200
Right 923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG 0: 1
1: 0
2: 3
3: 26
4: 346
923623013_923623020 26 Left 923623013 1:235593246-235593268 CCATGCTCTGTAAAATTCTGATG 0: 1
1: 0
2: 0
3: 18
4: 241
Right 923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG 0: 1
1: 0
2: 3
3: 26
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923623020 Original CRISPR GTAAATACAAAGTTGGGGCT GGG Intronic
900748107 1:4374984-4375006 GTAAATAAATATTTGAGGCTAGG + Intergenic
901009993 1:6195148-6195170 ATAAATAAAAATTTGGGGCCAGG + Intronic
901833026 1:11905643-11905665 GTAAAAAGAAACTTGGGGCCGGG - Intergenic
904161889 1:28528158-28528180 AAAAATACAAAATTTGGGCTGGG + Intronic
904186660 1:28710298-28710320 ATAAATACAAAGATCAGGCTGGG - Intronic
904528537 1:31153148-31153170 ATCAATACAAAGTTGTGGCCGGG - Intergenic
905591640 1:39168921-39168943 GAAAATACTGAGTTTGGGCTGGG - Intronic
907878316 1:58517802-58517824 GTCAATCCAAAGTAGGGGATTGG + Intronic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
912064061 1:105713076-105713098 GTAAATCCATAAATGGGGCTGGG - Intergenic
912317603 1:108680394-108680416 TTAAAAATAAAGTAGGGGCTGGG + Intergenic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
913001968 1:114589651-114589673 ATAAATGCAGTGTTGGGGCTGGG - Intronic
915438509 1:155928075-155928097 TTAAATACATTCTTGGGGCTGGG + Intronic
915925688 1:160017495-160017517 GGAAATCCAAAGTGGGTGCTAGG - Intergenic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916185020 1:162122798-162122820 GTAATTAAAAATTGGGGGCTGGG - Intronic
916357877 1:163933633-163933655 GTAAACACAAAGTCTGGGCTTGG + Intergenic
916879268 1:169003666-169003688 AGAAATAGTAAGTTGGGGCTGGG + Intergenic
917474061 1:175353091-175353113 GAGAATTCAAAGTCGGGGCTGGG + Intronic
917834884 1:178933628-178933650 GGAAATATACAGTTGAGGCTGGG + Intergenic
917874918 1:179277619-179277641 GAAAATACAAATATAGGGCTGGG - Intergenic
917918159 1:179725462-179725484 AAAAATATTAAGTTGGGGCTGGG - Intergenic
918569005 1:185965259-185965281 GTAAATGCAAATTTTAGGCTTGG + Intronic
921544238 1:216455140-216455162 GAAAATACAAAATAGGGGCCTGG + Intergenic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
924534674 1:244924751-244924773 GTAAATAAAAAAGTGAGGCTGGG - Intergenic
924610694 1:245571283-245571305 TTAAAAACATAGGTGGGGCTTGG - Intronic
1062892029 10:1069908-1069930 CAAAATACAAAGTTGAGGCCAGG + Intronic
1063978702 10:11436946-11436968 GAAAACACAAACTTAGGGCTTGG - Intergenic
1064762590 10:18636519-18636541 GTAAATACAAACTAGGTGGTAGG + Intronic
1065741064 10:28797564-28797586 GTAAAAAAAAAAATGGGGCTGGG + Intergenic
1065941625 10:30569472-30569494 CTAAAAACAAAGTCTGGGCTAGG - Intergenic
1066542984 10:36469188-36469210 GTAAATCCAAAGTTCATGCTTGG + Intergenic
1066654462 10:37685614-37685636 GTGCATACAGAGTAGGGGCTAGG - Intergenic
1067782714 10:49220710-49220732 TTAAATGGAAAGTTGAGGCTGGG + Intergenic
1067895028 10:50169541-50169563 GTGATTACAAAGGTGGGCCTAGG - Intergenic
1067953810 10:50770722-50770744 GTGATTACAAAGGTGGGCCTAGG + Intronic
1068770347 10:60813866-60813888 TTAAAAATAAAGTTGGGGCTGGG - Intergenic
1069755550 10:70772573-70772595 CCAAATACAAAGAAGGGGCTGGG + Intronic
1069955329 10:72047162-72047184 TTAAATACACTGTTGAGGCTGGG + Intergenic
1070171104 10:73933216-73933238 TAAAATGCATAGTTGGGGCTAGG + Intergenic
1071181247 10:82986025-82986047 GTGAATAGAAATTTAGGGCTTGG - Intronic
1071295678 10:84217592-84217614 GTAGATACAAAGCCGGTGCTAGG - Intronic
1073113230 10:101075163-101075185 ATAAATAAATAGCTGGGGCTTGG - Intergenic
1074441339 10:113479715-113479737 GTGACTACGAAGTTGGGGCTAGG + Intergenic
1076987271 11:247534-247556 GAAATTACTAAGGTGGGGCTGGG + Intronic
1077098112 11:808431-808453 GAAAAAAAAAAGTTGGGGCCGGG + Intronic
1077604398 11:3598427-3598449 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1078236804 11:9492406-9492428 AAAAATACAAAATTAGGGCTGGG - Intronic
1079158818 11:17973975-17973997 GTAATTCCAAAGTAGGGGGTTGG + Intronic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1079911581 11:26316907-26316929 GTAAATACAAAGTTGCATGTAGG - Intronic
1080394741 11:31879605-31879627 GTCATTAAAAAGTTTGGGCTGGG - Intronic
1083084042 11:60124222-60124244 GTAAATAGACACTTGGTGCTAGG - Intergenic
1083257469 11:61505566-61505588 AAAAATACAGAGTTGGGGGTGGG + Intergenic
1084226849 11:67721243-67721265 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1084260289 11:67973024-67973046 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1084482183 11:69428410-69428432 ATACATACAAAGCTGGGGATTGG - Intergenic
1084812479 11:71622225-71622247 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
1084845449 11:71895620-71895642 GTAAATGCTAAGTGGTGGCTGGG - Intronic
1087579278 11:100031252-100031274 GTAAATACAAAGTTGCATGTGGG + Intronic
1088379101 11:109173619-109173641 TTAAATACAAGGGTGGGGCCAGG - Intergenic
1088639188 11:111854564-111854586 ATAAATTCAAAGATGGGGCCAGG - Intronic
1089918745 11:122186386-122186408 GTAAATTCTAATTTGGGGGTGGG - Intergenic
1090463875 11:126915681-126915703 GAAAATACAAAGCTGAGCCTTGG - Intronic
1091200982 11:133781198-133781220 GTAGATGCACATTTGGGGCTGGG - Intergenic
1092434505 12:8436193-8436215 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1093936598 12:25008304-25008326 GAAAATACTAAATTGGGGCTGGG + Intergenic
1094198489 12:27774726-27774748 GAAAATAAAAAGCAGGGGCTGGG + Intergenic
1094678894 12:32649776-32649798 GTAAAAATAAAATTGGGGCCAGG - Intergenic
1095700698 12:45188234-45188256 AGAAATACAACGTTGGGGCCAGG + Intergenic
1096736937 12:53662977-53662999 ATAAAGACAAAGTTTTGGCTGGG + Intronic
1097544903 12:60986604-60986626 GGTAATAAAAAGTTGGGGCTGGG - Intergenic
1097727950 12:63095800-63095822 GAAAAGACAAAGTTCAGGCTGGG - Intergenic
1099012413 12:77307882-77307904 ATAAATACAAAGTGGTGCCTTGG - Intergenic
1100327476 12:93552986-93553008 GTAAATAAAAATTTGGGGGGAGG - Intergenic
1100599394 12:96099860-96099882 GAACATACGAATTTGGGGCTGGG + Intergenic
1101311594 12:103585676-103585698 GTAGATAAAAATCTGGGGCTTGG - Intergenic
1104312675 12:127668349-127668371 GAAACTATTAAGTTGGGGCTGGG + Intergenic
1106489483 13:30205657-30205679 GTACATTAAAAGTTAGGGCTGGG + Exonic
1106813572 13:33383446-33383468 TGAAATACAAAGCTGTGGCTGGG + Intergenic
1106957529 13:34957222-34957244 GAAAATACAGGGTTAGGGCTAGG - Intronic
1107546484 13:41438287-41438309 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1107936174 13:45346956-45346978 GAAAATAACATGTTGGGGCTGGG - Intergenic
1108061519 13:46538009-46538031 ATAAATGCAGAGTTGGGACTCGG - Intergenic
1109145778 13:58777520-58777542 GTAAAAGCAAAGGAGGGGCTGGG - Intergenic
1109650831 13:65323477-65323499 AGAAACACAAATTTGGGGCTGGG - Intergenic
1109821782 13:67666523-67666545 GTTTATATAAAGTTGAGGCTGGG - Intergenic
1110147666 13:72211941-72211963 GTAAATATAAGGTGGGGCCTGGG + Intergenic
1112557987 13:100486615-100486637 ACAAACACAAAGTTGAGGCTGGG + Intronic
1113184415 13:107671369-107671391 GATTATTCAAAGTTGGGGCTGGG + Intronic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1117039763 14:51759175-51759197 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
1117748449 14:58895789-58895811 GTAAAAACAAAATTGAGGGTGGG - Intergenic
1117945688 14:61017332-61017354 TTAAAAACAAAGTTAGGGCCGGG - Intronic
1118086874 14:62427758-62427780 ATAAAGACAAAGTTGGGGGTGGG + Intergenic
1118874934 14:69776077-69776099 GCAAATTCTAAGTTGGGGATAGG + Exonic
1119289591 14:73484673-73484695 GTTAATATAAAGTTTAGGCTGGG - Intronic
1120199793 14:81524574-81524596 TTAAAAACAAAGGAGGGGCTGGG + Intronic
1120670127 14:87353719-87353741 GTAAAGACATACTTGGGACTGGG + Intergenic
1120733077 14:88024466-88024488 GCAAACACAGGGTTGGGGCTAGG - Intergenic
1121024500 14:90605064-90605086 ATGAATATAAAGTTGGGGGTGGG + Intronic
1121029229 14:90643876-90643898 TTAAAAACAAACTTAGGGCTGGG - Intronic
1121570953 14:94946200-94946222 GTAAAAACAAAGGGGGTGCTGGG + Intergenic
1122728771 14:103779464-103779486 AAAAATAAAAATTTGGGGCTGGG + Intronic
1123847900 15:24322833-24322855 GGATACAGAAAGTTGGGGCTTGG - Intergenic
1126568489 15:50125493-50125515 GTTGATACAGAATTGGGGCTTGG - Intronic
1127946396 15:63758889-63758911 TTAAAAAAAAAGTTGGGGGTGGG - Intronic
1128042148 15:64584610-64584632 ATAAACATAAAGATGGGGCTGGG - Intronic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1128291953 15:66484827-66484849 GTAAACACAGTGTTGGGGGTAGG + Intronic
1128628460 15:69237297-69237319 TTAAAAACCAATTTGGGGCTGGG + Intronic
1129117430 15:73372533-73372555 CTAAATAAAAAGTTGGCACTGGG + Intergenic
1129512005 15:76131079-76131101 TAAAATACTAATTTGGGGCTAGG + Intronic
1129557631 15:76529339-76529361 TTAAATACAAAGTTCTGGCGGGG - Intronic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1130000831 15:80045224-80045246 GTAAATACAAGATGGTGGCTGGG + Intergenic
1133289118 16:4706530-4706552 GAAAATACAAAATTGTGGCTGGG - Intronic
1134514560 16:14876321-14876343 ATAAACACAAGGATGGGGCTTGG - Intronic
1134608835 16:15591876-15591898 GGAAAAAAAAAGTGGGGGCTTGG + Intronic
1134633422 16:15773910-15773932 GCAATTATAAAGTTGGGGGTGGG - Intronic
1134702237 16:16274974-16274996 ATAAACACAAGGATGGGGCTTGG - Intronic
1134969593 16:18519676-18519698 ATAAACACAAGGATGGGGCTTGG + Intronic
1137611987 16:49824448-49824470 GCCAATACCAAGTTGGGGGTGGG + Intronic
1137964264 16:52915189-52915211 GGAAAGACAGAGTTGAGGCTGGG - Intergenic
1138483800 16:57322454-57322476 ATAAGAACAGAGTTGGGGCTGGG + Intergenic
1138765954 16:59603808-59603830 ATAAATACAAACTTTGGACTAGG + Intergenic
1139000309 16:62501913-62501935 ATAAATACATAGTTGGTGCAAGG - Intergenic
1139712695 16:68788701-68788723 ATAAGAAGAAAGTTGGGGCTGGG + Intronic
1142658793 17:1413204-1413226 GAAAATGCAAACTTGGGGCCGGG - Intergenic
1144488221 17:15685286-15685308 AAAAATACAAAGTTCTGGCTGGG - Intergenic
1144770089 17:17754835-17754857 GTAACTACATAGTAGGTGCTTGG + Intronic
1144912799 17:18696996-18697018 AAAAATACAAAGTTCTGGCTGGG + Intergenic
1149584711 17:57778071-57778093 TTCAATACGAACTTGGGGCTTGG - Intergenic
1149953667 17:61021024-61021046 GTAAATATAAAGATGGGGAGGGG - Intronic
1150484476 17:65534200-65534222 GTAAACCCAAAGTGGGGGCTGGG + Intronic
1151080742 17:71325573-71325595 GGAAATATAAAGTTGGGGCAGGG - Intergenic
1151788651 17:76289640-76289662 TAAAAGACAAAGTGGGGGCTGGG + Intronic
1153356872 18:4146600-4146622 GTAATAACAAAGTTGGGGCTAGG + Intronic
1153521014 18:5953899-5953921 ACAAATACAAAGTGGGGCCTGGG + Intergenic
1153931807 18:9885726-9885748 GTAAAGAGAATGTTGGAGCTGGG + Intronic
1154150012 18:11899213-11899235 GTAAATAAGTAGTTTGGGCTGGG - Intronic
1155824333 18:30420037-30420059 CTAAATAAAAACTTGAGGCTGGG + Intergenic
1157237097 18:45975234-45975256 AAAAATACAAAATTAGGGCTGGG - Intergenic
1157354754 18:46922496-46922518 AAAAATAAAAAGTTGAGGCTGGG + Intronic
1160616649 18:80135732-80135754 GCAAATACACAGTTTGGGCAAGG - Exonic
1160977493 19:1800516-1800538 GTAAACACAAAGATAAGGCTGGG + Intronic
1162179007 19:8854190-8854212 TTAAAAAAAAAATTGGGGCTGGG + Intronic
1162235285 19:9304114-9304136 TGAAATACATATTTGGGGCTGGG - Intronic
1162415231 19:10532072-10532094 GAAAATACAAAATTAGGGCCCGG - Intergenic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1164867773 19:31619176-31619198 GAAAATACAAACATTGGGCTGGG + Intergenic
1165370947 19:35405709-35405731 CTAAAAACAAACTTGGGGCTGGG + Intergenic
1165962269 19:39545002-39545024 GAAAATACAAAGGTAGTGCTTGG + Intergenic
1167078055 19:47260829-47260851 GTAAATCCAAGGTAGGAGCTAGG + Exonic
1167824256 19:51957908-51957930 GCAAGCACAAGGTTGGGGCTAGG - Intergenic
1167824646 19:51961088-51961110 GTGAGCACAAGGTTGGGGCTAGG + Intergenic
1168601025 19:57718744-57718766 AAAAATACAAAATTAGGGCTGGG + Intronic
925202827 2:1982665-1982687 GGAGAGACAAAGCTGGGGCTGGG + Intronic
925666350 2:6260555-6260577 GAAAATACAAAATTGGGGGATGG + Intergenic
926409599 2:12589194-12589216 GTAAATAGAAACTTGTGACTTGG + Intergenic
928836661 2:35555681-35555703 GTAAAGACATACTTGAGGCTGGG + Intergenic
929149395 2:38734101-38734123 ATAAATAAAAAGTTGAGGCCGGG + Exonic
929455653 2:42063044-42063066 ATAAAAACAAAGTTCAGGCTGGG + Intergenic
930052377 2:47226306-47226328 GTAAATAGAAAGTTGGGACCTGG - Intergenic
931521180 2:63098942-63098964 GCAAATAGAAAGTTGGGGTAAGG - Intergenic
932804950 2:74775627-74775649 ATAAAAACAGAGTTGGGGCCAGG + Intergenic
932839653 2:75070198-75070220 ATACATACAATGTTGGGGGTAGG - Intronic
933094262 2:78158025-78158047 GTAAAAACAAACTAGGGGTTTGG + Intergenic
933406767 2:81870265-81870287 GTAAATACATAGGTGGGGCTTGG - Intergenic
933508474 2:83208704-83208726 GAAAATATAAAATTTGGGCTAGG - Intergenic
933664764 2:84956009-84956031 AAAAATACAAAATTAGGGCTGGG + Intergenic
935273031 2:101451390-101451412 AGAAATACAACCTTGGGGCTGGG + Intronic
937075645 2:119104335-119104357 GCAAATATAAAGCTGGGGCTGGG - Intergenic
937416215 2:121717061-121717083 GTAAAAAGAAAGTTTCGGCTGGG - Intergenic
937448843 2:121983305-121983327 ATAAAAAGAAAGTTGGGGCTGGG - Intergenic
937620077 2:123975320-123975342 AAAAATACAAATTTCGGGCTAGG + Intergenic
938306622 2:130260869-130260891 TAAAACACAAAGTTGAGGCTGGG + Intergenic
940367067 2:152860258-152860280 GTTAAGACAAATTTGAGGCTGGG + Intergenic
940870453 2:158855774-158855796 GTAAATGCTAAGTGGTGGCTGGG - Intronic
940873161 2:158876898-158876920 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
940916278 2:159259318-159259340 GTAAAGACCAAGTTGTGGCCGGG - Intronic
941329144 2:164155933-164155955 GCAAAAACAAAGCTGTGGCTTGG - Intergenic
941519507 2:166521785-166521807 TTAAAAATAAAGTTGAGGCTGGG + Intergenic
941669280 2:168273819-168273841 GTAAATATATAGTAGTGGCTAGG - Intergenic
941772115 2:169356186-169356208 TGAAATACATAGTTGAGGCTGGG - Intronic
942134638 2:172912617-172912639 GTAAATATAAATTAGGGTCTAGG - Intronic
942549234 2:177097297-177097319 TAAAATACAAATTTGGGGTTGGG + Intergenic
943504929 2:188743166-188743188 ATAAATACAAATTTGAGGGTAGG - Intronic
944508055 2:200435251-200435273 GTATATACAAAATTGGGATTTGG + Intronic
944783585 2:203045084-203045106 TTAATTATAAAATTGGGGCTTGG - Intronic
944801386 2:203240527-203240549 GTAGAAATAAAGTTGGGGATAGG + Intronic
945089726 2:206167559-206167581 TTAAAAACAAAGTTTAGGCTGGG - Intergenic
946630226 2:221659146-221659168 ATAAATAAAAATTTGGGGCCCGG + Intergenic
1170614255 20:17936358-17936380 GAAAATACAACGTTGGAGTTGGG + Intergenic
1170616456 20:17956425-17956447 TTAAAAACAAAGCTGGGGCCCGG + Intronic
1171964629 20:31520150-31520172 CTAAATAAAAAGTGTGGGCTGGG - Intronic
1173480258 20:43393026-43393048 GTACAGACAAAGATGGGGATGGG + Intergenic
1175314041 20:58033488-58033510 GTCCATATAAAGTTGGGGATGGG + Intergenic
1175384707 20:58586873-58586895 GTAAATAGAAAGTTGGCATTTGG + Intergenic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1175827178 20:61942583-61942605 GTAAAAACAAGGGTGGTGCTGGG + Intergenic
1175942576 20:62544608-62544630 GTAAAGATAAACCTGGGGCTCGG + Intergenic
1177322928 21:19545499-19545521 GTAAAGACATAGTTGAGCCTAGG + Intergenic
1177424955 21:20910549-20910571 TAAAAAACAAAGTTAGGGCTGGG - Intergenic
1177601708 21:23323892-23323914 ATAAATACCAAGTTGAGTCTAGG + Intergenic
1179636478 21:42714310-42714332 GTAAAATAAAAGTTGGGGCTGGG - Intronic
1180923668 22:19537135-19537157 AAAAGTACATAGTTGGGGCTGGG - Intergenic
1182247269 22:28969131-28969153 TTAAAACCAAAGTTTGGGCTAGG - Intronic
951618461 3:24574648-24574670 GTAAATAAACAGTTGTGGCTGGG - Intergenic
952802361 3:37307936-37307958 GTACATGAAAATTTGGGGCTGGG + Intronic
952926478 3:38323871-38323893 CTCAATACAAAAATGGGGCTAGG - Intergenic
953945414 3:47142994-47143016 GAAAAATGAAAGTTGGGGCTGGG + Intronic
954179096 3:48867548-48867570 AAAAATACAAACTTTGGGCTGGG - Intronic
954705226 3:52476736-52476758 TTAATTACAAAATGGGGGCTGGG + Intronic
955027528 3:55184029-55184051 GGAAAAAGAAAGTTGGGGATGGG + Intergenic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
957820620 3:85369471-85369493 GAAAATACAAAATTTCGGCTGGG + Intronic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
959140733 3:102483619-102483641 TTAAATAAAAAATTCGGGCTGGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960510230 3:118540691-118540713 GCAAGCACAGAGTTGGGGCTAGG + Intergenic
961275938 3:125726707-125726729 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
961278853 3:125749287-125749309 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
961527424 3:127514530-127514552 TTAAATATAAAATTTGGGCTTGG - Intergenic
962504307 3:136030215-136030237 CTCAATAAAAAGTTGGGGCGGGG + Intronic
963199311 3:142569938-142569960 ATAAAAAAACAGTTGGGGCTGGG - Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
966848688 3:184150520-184150542 ATATATACAAAATTAGGGCTGGG + Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
969023537 4:4155274-4155296 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
969602371 4:8183845-8183867 CTAAATACAAAGTGGGGTCCTGG - Intronic
969730273 4:8951807-8951829 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
969789878 4:9485919-9485941 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
970068671 4:12129284-12129306 ATAAAAACAAACTTGGGGCTAGG - Intergenic
970682719 4:18529228-18529250 GTATATACAAGGTTGGAGCAAGG - Intergenic
971747892 4:30608352-30608374 GTAATTACAAAGTTGTGACTTGG + Intergenic
972927956 4:44035611-44035633 TAACATACAAAGTTGGTGCTTGG + Intergenic
974574960 4:63706779-63706801 GAAAATACCAATTTGTGGCTGGG + Intergenic
975688203 4:76938918-76938940 GTAAGAACCAAGTTGGGGCCGGG + Intergenic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
976153368 4:82115624-82115646 GAAAATGAAAAGTAGGGGCTTGG - Intergenic
976873340 4:89823144-89823166 GTAGATAATAAGTAGGGGCTGGG - Intronic
977692466 4:99929587-99929609 GTAAATAAAAAGTTGAGAATGGG + Intronic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978197432 4:105987726-105987748 GTTAATACAAAATTGCAGCTGGG - Intronic
979291080 4:118979559-118979581 GGAAATACAAAGTTAGGCCAGGG - Intronic
980164317 4:129206655-129206677 GTGAGTACAAGGTTGGGGCAGGG - Intergenic
980574100 4:134663307-134663329 GTAAATTGAAAGGTTGGGCTAGG + Intergenic
980890673 4:138811292-138811314 GTAAAAACAAACTTGAGGCTGGG - Intergenic
982117744 4:152112238-152112260 GTAAATCCAGAGCTGGGGGTGGG - Intergenic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
986694883 5:10342806-10342828 TTAAATATACAGTTGGGGCTGGG - Intergenic
987018531 5:13846132-13846154 TAAAATAAAAAGTTGGGGCCAGG - Intronic
988211192 5:28206414-28206436 GTAAATAACATGTTGGGGCTGGG - Intergenic
989414982 5:41163604-41163626 TTAAAAACAAAGTTCAGGCTGGG - Intronic
990030980 5:51259055-51259077 GTAGATGCAAATTTTGGGCTTGG - Intergenic
990319301 5:54613852-54613874 GAAAATACAAAATTAGGGCATGG - Intergenic
991245213 5:64503164-64503186 GTAGAAAGAAAATTGGGGCTGGG + Intergenic
991264800 5:64705115-64705137 GTAAATAATGAGTTGAGGCTGGG + Intronic
992549969 5:77850917-77850939 ATAAATACTGAGCTGGGGCTGGG - Intronic
992667815 5:79028133-79028155 ATAAAAAAAAAGTGGGGGCTGGG - Intronic
993210602 5:84945726-84945748 GTAAAGACATACTTGGGACTGGG - Intergenic
993764993 5:91844997-91845019 GAAAATACAAAATTAGGGCCGGG - Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
996401339 5:123066396-123066418 AAAAATAGAAAGTTGTGGCTGGG + Intergenic
998681946 5:144477760-144477782 GTAGATACAAAGTTGAAGGTTGG - Exonic
999969827 5:156848275-156848297 GAAAATACAGAGTTAGGGCCAGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000619244 5:163464318-163464340 GTAATTAGAAATTTGGGGCCGGG + Intronic
1000790186 5:165596833-165596855 GAAAAAACAAATTTGAGGCTAGG - Intergenic
1001142385 5:169155532-169155554 GTAGATACAAGGCTGGGACTGGG + Intronic
1001526120 5:172430085-172430107 CTAACTGCAAAGTTGGGGCGAGG + Intronic
1001544347 5:172561179-172561201 GCAAATATAAAGAAGGGGCTGGG - Intergenic
1001908460 5:175493348-175493370 GTCAATCCAAAGCTGGGGATTGG + Intronic
1002038853 5:176495804-176495826 ATTAATAGAAAGTTGAGGCTGGG - Intronic
1004355158 6:14924116-14924138 ATAAATTCAGAGTTGGGGGTGGG + Intergenic
1005631817 6:27715219-27715241 CAAAAAACAAAGTTGGGGCAGGG + Intergenic
1005678433 6:28180683-28180705 GGAACTTCCAAGTTGGGGCTTGG + Intergenic
1005777159 6:29146651-29146673 GTAAATACAAAGTTGTGAGAAGG - Intergenic
1005940934 6:30559080-30559102 GAAAATATAAATTTGCGGCTGGG + Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006541010 6:34739646-34739668 AAAAATAGAAAGTAGGGGCTGGG - Intergenic
1007041144 6:38723577-38723599 AGAAAGACAAAGTTGGGGCAGGG + Intronic
1007497571 6:42270926-42270948 AAAAATACAAAATTTGGGCTTGG - Intronic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1008772452 6:54995304-54995326 TAAAACAAAAAGTTGGGGCTGGG + Intergenic
1010461951 6:76123787-76123809 TTAAATACATATTTGTGGCTGGG - Intergenic
1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG + Intergenic
1015424833 6:133053571-133053593 TTAATTAGAAAGTTGGGGCCAGG + Intergenic
1015926692 6:138317321-138317343 GTAAATCCAGAGTTGGTGGTTGG - Exonic
1015986438 6:138888648-138888670 TCAAAAACAAAGTTGGGGGTTGG - Intronic
1016407869 6:143749419-143749441 GTAAATGCAAAGTTTTAGCTTGG + Intronic
1016819152 6:148331622-148331644 GTAAAGACCAAGTTCTGGCTGGG - Intronic
1017121815 6:151031064-151031086 CTGAGTACAAAGTTGAGGCTGGG - Intronic
1019693374 7:2430611-2430633 GAAAATACAAAATTTAGGCTGGG - Intronic
1019947171 7:4339016-4339038 GTAAAGACATATCTGGGGCTGGG + Intergenic
1020310643 7:6865443-6865465 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1021376756 7:19917812-19917834 GTAAAAACTAATTTGGGGCAGGG - Intergenic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022546607 7:31194916-31194938 GTAAATCCAATGCTGTGGCTAGG + Intergenic
1023743983 7:43304787-43304809 GTAAATACTTTGTTGAGGCTGGG - Intronic
1025938479 7:66056369-66056391 GTAGAAGAAAAGTTGGGGCTGGG + Intergenic
1026589236 7:71681194-71681216 GGAAATGCAAAACTGGGGCTGGG - Intronic
1028693183 7:93677089-93677111 GTTATTACAAAGTTGTGGCCAGG + Intronic
1029247214 7:99210879-99210901 GAACATTCAAAGTTGGGGCCAGG - Intergenic
1029342183 7:99954266-99954288 GAAAATACTAATATGGGGCTAGG - Intergenic
1029415356 7:100439566-100439588 GAAAAAAAAAAGTTGGGGTTCGG + Intergenic
1030406547 7:109121867-109121889 ATAAATACAAAGTTGTTGCCTGG - Intergenic
1031293343 7:119967541-119967563 GTAAATACAAACCTGAGACTCGG - Intergenic
1031741593 7:125438448-125438470 GTAAATTAAAATTTGGGGCAAGG + Intergenic
1032162825 7:129523732-129523754 TTAAATACAAAGTTGGGGCCGGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035433047 7:158836777-158836799 GTAAAGACATAGCTGAGGCTGGG - Intergenic
1035819892 8:2579938-2579960 GTGAACCCAATGTTGGGGCTTGG + Intergenic
1036261618 8:7245385-7245407 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1036304976 8:7594171-7594193 GTAAATGCTAAGTGGTGGCTGGG - Intergenic
1036313658 8:7703929-7703951 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1036832515 8:12032407-12032429 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1036902686 8:12682932-12682954 GTAAATGCTAAGTGGTGGCTGGG + Intergenic
1037165567 8:15824384-15824406 ATATATACAAACTTGGTGCTAGG + Intergenic
1038428917 8:27484309-27484331 CTAAATAAAAAGTTGGTCCTTGG - Intergenic
1038695285 8:29801007-29801029 GAAAATGTAAAATTGGGGCTGGG - Intergenic
1039003773 8:33011021-33011043 GTAAATTCAGAGATGGGGGTGGG - Intergenic
1040356044 8:46619316-46619338 GTTAAAACAAAATTGAGGCTGGG + Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1040995465 8:53396668-53396690 ATAAAATCAAAGTTGTGGCTAGG - Intergenic
1044004289 8:86922930-86922952 GAAACTACAATGTTGGGGATGGG + Intronic
1044502307 8:92972562-92972584 GCAAGTAGAAAGTTGGAGCTAGG - Intronic
1045408192 8:101888710-101888732 GTTAATAGAAAGTTCAGGCTGGG - Intronic
1045713519 8:105014565-105014587 AAAAATATAAAGTTGGGGCCGGG - Intronic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1046181246 8:110651622-110651644 TTAAAAACATAGTTGGGGATGGG - Intergenic
1047354609 8:124108587-124108609 GTAAGAAAAAAGATGGGGCTGGG + Intronic
1048017218 8:130508049-130508071 GAACATACAAAGTTGTTGCTAGG - Intergenic
1048411793 8:134182641-134182663 ATAAAAACAGAGTTGGGGATGGG + Intergenic
1048689842 8:136950064-136950086 GTGAATAAAAATTTAGGGCTGGG + Intergenic
1049064757 8:140304388-140304410 TTAAAAAAAAAATTGGGGCTGGG - Intronic
1051346430 9:16154997-16155019 GTAAAGACAAAGATGGGAGTCGG - Intergenic
1051480746 9:17557214-17557236 GCAAATACAAAATTGGGTCAAGG - Intergenic
1051761447 9:20470199-20470221 GGAAATACAAACTTGGCTCTAGG + Intronic
1053205401 9:36182167-36182189 AGAAATACAAACTTTGGGCTGGG + Intergenic
1053534487 9:38912472-38912494 AAAAATACAAAATTAGGGCTGGG - Intergenic
1054206708 9:62136891-62136913 AAAAATACAAAATTAGGGCTGGG - Intergenic
1054631644 9:67451456-67451478 AAAAATACAAAATTAGGGCTGGG + Intergenic
1054885477 9:70193077-70193099 GTAAGTACAAAGATAGGCCTAGG + Intronic
1054984415 9:71245151-71245173 ATAAATACAAAGAAGAGGCTGGG + Intronic
1055166992 9:73208925-73208947 GTATATACAACATGGGGGCTTGG + Intergenic
1055389134 9:75800168-75800190 TTAAATAGAAAGTTTGGGCTGGG + Intergenic
1055928225 9:81532534-81532556 TAAAATACAAATTTTGGGCTGGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056567357 9:87785783-87785805 GCAATCACAAGGTTGGGGCTAGG + Intergenic
1056899858 9:90587915-90587937 GTAGCTACAGAGTTGGGCCTGGG + Intergenic
1059700638 9:116772478-116772500 TTAAATACATACTTGAGGCTGGG - Intronic
1061069136 9:128298006-128298028 TTAAATAAAGATTTGGGGCTGGG + Intergenic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186953217 X:14651294-14651316 GTAATTCCAAAGCTGGGGATAGG + Intronic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1187668910 X:21649104-21649126 AGAAATACAAATTGGGGGCTGGG + Intronic
1187980897 X:24756264-24756286 AAAAATACAAAGTTTGGGCCGGG + Intronic
1188974959 X:36662100-36662122 GTAAATACAAAGTTGCGTGCGGG + Intergenic
1189477636 X:41368405-41368427 TTAAAAAAAAAGTAGGGGCTGGG - Intergenic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1190299841 X:49050674-49050696 TTTAAGACAAGGTTGGGGCTGGG + Intergenic
1190837254 X:54112544-54112566 GAAAATACAAAATTAGGGCCGGG + Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1195057471 X:101159941-101159963 GTAAGTAGTCAGTTGGGGCTTGG + Intronic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic
1198477859 X:137012817-137012839 TTAATTACAAACTTTGGGCTGGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1200136429 X:153877146-153877168 AAAAATACAAAATTAGGGCTGGG + Intronic
1201271262 Y:12257492-12257514 GTAAATACAGAGCTAGGACTTGG + Intergenic