ID: 923623789

View in Genome Browser
Species Human (GRCh38)
Location 1:235598007-235598029
Sequence GTCTTGGGTAGCCAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923623789_923623802 9 Left 923623789 1:235598007-235598029 CCCTGACTCTGGCTACCCAAGAC 0: 1
1: 1
2: 0
3: 16
4: 140
Right 923623802 1:235598039-235598061 AGGGCTGAGGTGCTGGATCAAGG 0: 1
1: 0
2: 1
3: 24
4: 330
923623789_923623792 -10 Left 923623789 1:235598007-235598029 CCCTGACTCTGGCTACCCAAGAC 0: 1
1: 1
2: 0
3: 16
4: 140
Right 923623792 1:235598020-235598042 TACCCAAGACCCCACCCAGAGGG No data
923623789_923623795 -4 Left 923623789 1:235598007-235598029 CCCTGACTCTGGCTACCCAAGAC 0: 1
1: 1
2: 0
3: 16
4: 140
Right 923623795 1:235598026-235598048 AGACCCCACCCAGAGGGCTGAGG 0: 1
1: 0
2: 2
3: 35
4: 294
923623789_923623803 22 Left 923623789 1:235598007-235598029 CCCTGACTCTGGCTACCCAAGAC 0: 1
1: 1
2: 0
3: 16
4: 140
Right 923623803 1:235598052-235598074 TGGATCAAGGCTGTACCTGTAGG No data
923623789_923623799 2 Left 923623789 1:235598007-235598029 CCCTGACTCTGGCTACCCAAGAC 0: 1
1: 1
2: 0
3: 16
4: 140
Right 923623799 1:235598032-235598054 CACCCAGAGGGCTGAGGTGCTGG 0: 1
1: 0
2: 1
3: 30
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923623789 Original CRISPR GTCTTGGGTAGCCAGAGTCA GGG (reversed) Intronic
901511711 1:9721018-9721040 GTGGTGGGTGGCCAGGGTCAGGG - Intronic
903071645 1:20729748-20729770 GTCATGGGCAGGCAGAGACAGGG - Intronic
903223308 1:21880923-21880945 GTCTCAGGTAGGCAGAGTGAGGG - Intronic
906684807 1:47756496-47756518 GTCAGGGGGAGCCAGAGTCCTGG - Intergenic
907326149 1:53639722-53639744 GGCTTGGGAAGCCAGTCTCAAGG + Intronic
907833158 1:58084617-58084639 GGCTTGGGTTGCCAGAGACCTGG + Intronic
911150095 1:94590233-94590255 GTCTTGGTCAGCCAGAGCCAAGG + Intergenic
913274707 1:117125720-117125742 GTCTGGGGAAGCAATAGTCATGG + Intergenic
913317944 1:117568062-117568084 GTTTTGTCTAGCCAGAGTGATGG + Intergenic
913435912 1:118847574-118847596 GTCCTGAGTACCCAGAGTCAAGG + Intergenic
917741679 1:177967409-177967431 GGCTTGGGGAGGCAGTGTCAAGG - Intronic
917808038 1:178631652-178631674 GACTTGGGTAGCAAGAGATATGG + Intergenic
918121857 1:181547284-181547306 GGCATCGGTGGCCAGAGTCAGGG - Intronic
918424351 1:184393072-184393094 GTCTTGGGGAGGCTGAGGCAGGG - Intronic
922161306 1:223080723-223080745 CTCATGAGTAGCCAGGGTCAGGG + Intergenic
922731815 1:227952494-227952516 GTCTTGTGTGGGCATAGTCAGGG - Intergenic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
1062874312 10:932216-932238 GTCCTGGGTGGCCAGGGTCGGGG - Intergenic
1066380769 10:34899580-34899602 GTCTTGAATATCCAGAGCCACGG + Intergenic
1067072250 10:43141802-43141824 GTCTTGGGCATCCTGAGCCAGGG + Intronic
1070794035 10:79206681-79206703 GCCTTTGGGAGACAGAGTCAGGG + Intronic
1073828107 10:107349248-107349270 GACTTGGGTAGGTAGAATCAGGG - Intergenic
1075861279 10:125678998-125679020 GTCTTTGGTGGCCACAGTCTGGG + Intronic
1077942048 11:6853231-6853253 GTTTAGGGTAGCCATAGTTAAGG - Intergenic
1078969647 11:16393079-16393101 GTCTCAGGGAACCAGAGTCACGG - Intronic
1081765563 11:45607785-45607807 GTCTAGGGTAGCCACGCTCAGGG - Intergenic
1084792116 11:71481551-71481573 GTCTGTGCTAGCCAGAGGCAAGG + Intronic
1088857326 11:113767872-113767894 GTTTTAGGTAGGCAGAGGCATGG - Intronic
1091877265 12:3945997-3946019 GCATTGGGTAGTGAGAGTCATGG - Intergenic
1092122660 12:6055478-6055500 GTCTTGGGGAGCCACAGGCTAGG - Intronic
1093906910 12:24703866-24703888 GTTATGGGAAGCCAGGGTCAAGG - Intergenic
1094464269 12:30735388-30735410 GTCTCAGGTAACCAGAGCCAAGG + Intronic
1100215611 12:92445045-92445067 GCATAGGGTAGCCAGTGTCACGG - Intergenic
1102988860 12:117300451-117300473 GTCCTGGGTGGTCAGAGCCAGGG - Intronic
1104623856 12:130337679-130337701 GTCTTGGGGGGCCAGGGGCAGGG + Intergenic
1112658818 13:101483220-101483242 TTCCTGGGTAGCCTGACTCAGGG + Intronic
1115806984 14:37062838-37062860 TTCAAGGGTACCCAGAGTCAAGG - Intronic
1121210779 14:92206854-92206876 GTCAAGGGGAGCCAAAGTCAAGG + Intergenic
1121310846 14:92934251-92934273 AACTTGGGTAGCCAGAGTTCGGG + Intronic
1123493257 15:20799544-20799566 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1123549764 15:21368646-21368668 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1124209102 15:27747483-27747505 ATGTTGGGGAGCCAGTGTCAGGG + Intergenic
1126132245 15:45353138-45353160 CTCTGGGGTAGCCAGAGTGGAGG + Intergenic
1126703068 15:51384636-51384658 GTCCTGGGGAGCCGGGGTCAGGG + Intronic
1127276159 15:57446124-57446146 GTCTTGGGAACACAGAGGCAGGG + Intronic
1129700195 15:77763368-77763390 GTACTGGGTCCCCAGAGTCAGGG - Intronic
1130045357 15:80440051-80440073 GTCTTGGTAGGCCAGAGTCTAGG + Intronic
1130484274 15:84389856-84389878 GTCTTGGCTGGCCAGGGTCCTGG + Intergenic
1131160326 15:90101377-90101399 GTGTTGGGTAGCCAGGGTGAGGG + Intronic
1202958095 15_KI270727v1_random:95864-95886 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1134815919 16:17205930-17205952 GTCTTGGGAACACAGAGACATGG + Intronic
1136072103 16:27793752-27793774 CTCCTGGGTAGCCAGAGAAAGGG - Intronic
1140645162 16:77022026-77022048 GTCTTTGGTAGGCAGAATTATGG - Intergenic
1143150372 17:4804096-4804118 GTTTGGGGTGGCCAGAGCCAAGG + Intergenic
1144275944 17:13668122-13668144 GGCTGTGGTAGGCAGAGTCAGGG - Intergenic
1144706688 17:17373187-17373209 GTGCTGGGAAGCCAGAGACAGGG - Intergenic
1145102076 17:20085854-20085876 GCCGTGGGTACCCAGAGTCGTGG - Intronic
1147215400 17:38896226-38896248 GTCTTGATTATCCATAGTCAGGG + Intronic
1154450812 18:14474082-14474104 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1156890389 18:42184138-42184160 GAGTTGGGTAGCCACAGACAAGG - Intergenic
1157479229 18:48042524-48042546 GTCCTGGGAAGGCAGAGGCAGGG + Intronic
1157806412 18:50661252-50661274 GACTTGGGCAGCAGGAGTCAAGG + Intronic
1161394899 19:4039812-4039834 GTCTTGGCCACCCAGAGACATGG - Intergenic
1162827760 19:13264154-13264176 CTCTTGGGGGGCCTGAGTCATGG - Intronic
1166390989 19:42408860-42408882 GACCTGGGTAGCGACAGTCAGGG + Intronic
1166530590 19:43540877-43540899 GGCTTTGGTAGGCAGAGTAATGG + Intergenic
1167591307 19:50405954-50405976 GGCTGGGATAGCGAGAGTCAGGG - Intronic
926482838 2:13421283-13421305 GTCGAGGGGAGCCAGAGTGATGG + Intergenic
926903795 2:17787021-17787043 GTCTTAGGTGGCTAGAGCCAAGG - Exonic
929580002 2:43076048-43076070 GCCTTGAATAGCCTGAGTCATGG - Intergenic
931677060 2:64707889-64707911 GTCTTGGATTGGCAGAGGCATGG + Intronic
932122614 2:69115581-69115603 GTGTTGGGTCTCCAGAGTCCAGG + Intronic
935268088 2:101411560-101411582 GTTTTGGTTAGCCAGAGTGTTGG + Intronic
936974486 2:118205514-118205536 ATCATGGCTAGGCAGAGTCAAGG + Intergenic
940592539 2:155748281-155748303 GTCTTAGGCAGCCACAGTCATGG - Intergenic
946857069 2:223961282-223961304 GTTTTGGGAAGACAGTGTCAAGG + Intronic
948964129 2:241363136-241363158 GTTTTGGACAGCCAGAGTCCAGG - Intronic
1168786220 20:542882-542904 GTTTTGGGGAAGCAGAGTCAGGG - Intronic
1169353465 20:4888893-4888915 GTCCTGGTTAGCCAGATTCAGGG + Intronic
1171392730 20:24811793-24811815 GTATTGGGTAGGCAGCGTCAGGG - Intergenic
1171392767 20:24811913-24811935 GTATGGGGTAGACAGTGTCAGGG - Intergenic
1172158367 20:32846075-32846097 GTCTTGGCTAGATAGAGTCCTGG + Intronic
1175148565 20:56915005-56915027 GTCTTGGGGAGCTAAAATCAAGG - Intergenic
1176445421 21:6816492-6816514 GTCCTCGGGAGCCAGAGTCCAGG + Intergenic
1176823589 21:13681525-13681547 GTCCTCGGGAGCCAGAGTCCAGG + Intergenic
1178414548 21:32393158-32393180 GTCTTGGGGATCCAGAGTCTTGG + Exonic
1179544671 21:42106167-42106189 GTCTTCGGACGCCAGAGTCGGGG + Intronic
1179878703 21:44284583-44284605 CTTTTGGGCAGCCAGAGTCCAGG - Intergenic
1182064206 22:27418828-27418850 GCATTGGGTAGGTAGAGTCAGGG - Intergenic
1183196727 22:36358619-36358641 GTCTTGGGTGGCCAGATGGATGG - Intronic
1184242360 22:43217863-43217885 GAGTTGGGGAGCCTGAGTCAGGG - Intronic
949531157 3:4956890-4956912 GTCTTGAATAGCCAGATTCTTGG + Intergenic
950413237 3:12852821-12852843 CTCTTGGCTGGCCACAGTCAGGG - Intronic
950873747 3:16251491-16251513 CTCTGGGGGAGCTAGAGTCATGG - Intergenic
951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG + Intronic
953688471 3:45096827-45096849 CTCTGGGGTAACCACAGTCACGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
967819838 3:193830676-193830698 TCCTTGGGTGGCCAGAGCCAGGG - Intergenic
967956525 3:194881517-194881539 GTCTTGGGTAGCCAGAGGCAGGG - Intergenic
968672955 4:1862228-1862250 GTCTTTGGCAGCCTGAGTTAGGG - Intergenic
976808549 4:89075038-89075060 TTCTTGGTTGGCCAGAGTGAGGG - Intronic
977621447 4:99142251-99142273 GTCCTGGGTATCCAGAGGAAGGG - Intronic
978884870 4:113756380-113756402 GGCTTGGGTATACAGAGTCATGG + Intronic
979451398 4:120875208-120875230 TTCTAGGGTGGCCTGAGTCAGGG - Intronic
982068630 4:151675689-151675711 GTCTTGGGTAGGCAGCAGCAGGG - Intronic
982474425 4:155832960-155832982 GTGTGGGGAAGCCAGAGTCAGGG - Intronic
982496664 4:156103178-156103200 GTCTGGGTTAGACATAGTCATGG - Intergenic
984035410 4:174661703-174661725 GTCTGGTGGAACCAGAGTCAAGG - Intronic
985338114 4:188917781-188917803 CTCTTGGGTGACCAGAGGCATGG + Intergenic
986888821 5:12275019-12275041 GCCTGGGGTAGGCAGTGTCATGG - Intergenic
990868875 5:60409347-60409369 GTCTTGTGTGGCCAGAGAGATGG + Intronic
995805816 5:116051278-116051300 GTCTGGGGGAGTCAGAGGCAAGG + Intronic
995850151 5:116536410-116536432 GTCCTGGGGAGCCCGAGTCATGG + Intronic
995913864 5:117219771-117219793 CTCTTGGGTCTCCAGAGTGAGGG - Intergenic
998415735 5:141945030-141945052 TTCTTGGGTAGCAGGAGTCAGGG - Exonic
999302883 5:150501988-150502010 GGCATGGGTGGCCAGAGGCAGGG + Intronic
1006112970 6:31759907-31759929 GCCTTGAGTAGCCATAGTCCCGG - Exonic
1006980757 6:38146009-38146031 GTCTTTGGTAGCAACAGTCAGGG + Intronic
1010541912 6:77101995-77102017 GTCTTGGGTTGGCACTGTCAAGG + Intergenic
1011408808 6:87044320-87044342 TTTTTGGGTATCCACAGTCATGG - Intergenic
1012552729 6:100478974-100478996 GTGTTGGTTAGCCAGGGTGAAGG + Intergenic
1014611513 6:123553466-123553488 GTCTGGTGCAGGCAGAGTCATGG - Intronic
1017717104 6:157220655-157220677 GTATTGGGTGGGCACAGTCATGG + Intergenic
1017748067 6:157464924-157464946 GTCTTGGGTAACCAGCCTCTAGG + Intronic
1018862713 6:167722760-167722782 GCCCTGGGGAGCCAGAGTCTGGG - Intergenic
1023998350 7:45175590-45175612 GTCGTGGGTTCCCAGACTCAAGG - Intronic
1026369461 7:69684148-69684170 GTCTTGGGGAGGAAGAGTCATGG + Intronic
1030756715 7:113294923-113294945 GTCTGTGGTAGCCAGGGGCAGGG - Intergenic
1034065159 7:148129151-148129173 GTCTTGGGGAGCCTGTGTCCTGG - Intronic
1035786724 8:2266911-2266933 GCCTTGGGTAGCAAGAGTCTAGG + Intergenic
1035806083 8:2454805-2454827 GCCTTGGGTAGCAAGAGTCTAGG - Intergenic
1038368981 8:26969168-26969190 GTCTTGTGTAGTGAGAGGCAAGG + Intergenic
1039162617 8:34639513-34639535 GTCTTTGGTATCCACACTCATGG - Intergenic
1039748403 8:40454088-40454110 GCCTTGGGTAGGGAGACTCATGG + Intergenic
1047255443 8:123210167-123210189 GTCTTGGGAATCCAGAGCAATGG - Intergenic
1049553226 8:143270238-143270260 CTCTTGGGGAGTCAGAGTCCTGG + Intronic
1050279064 9:4031924-4031946 TTCCTGGCTAGCCAGAGTCTAGG - Intronic
1050619560 9:7438551-7438573 GTCTTGGGGTGCCAGAATCTAGG + Intergenic
1051035383 9:12738473-12738495 GTCCAGGGAGGCCAGAGTCAGGG - Intergenic
1053318473 9:37073503-37073525 GTCCTGGATATTCAGAGTCAGGG + Intergenic
1053322545 9:37112890-37112912 GTCCTGGATATTCAGAGTCAGGG + Intergenic
1059879550 9:118675087-118675109 GTCCTGGGAAGCCTGAGTCTGGG + Intergenic
1060032640 9:120228649-120228671 GACTTGGGTACCCAGTGTCTGGG + Intergenic
1060055180 9:120407052-120407074 GGCTTGGACAGCCAGAGTGAGGG + Exonic
1060290261 9:122295861-122295883 GTTCTGGGTATCCAGAGTTAAGG - Intronic
1061111276 9:128573156-128573178 ATCTTGGGTAGGCATAATCAAGG + Intronic
1203523774 Un_GL000213v1:68033-68055 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1187306179 X:18097192-18097214 GGCATGGGTAGTCAGAATCAGGG + Intergenic
1188107690 X:26163759-26163781 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188111079 X:26196988-26197010 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188187577 X:27133523-27133545 GTCCTGGGTAACCAGACACATGG - Intergenic
1189213608 X:39304822-39304844 AGCTTGGGCAGCCAGTGTCAAGG + Intergenic
1195487189 X:105422958-105422980 TTTTAGGGCAGCCAGAGTCAAGG + Intronic
1197119377 X:122871947-122871969 CACTAGGGTAGCCAGAGTCTTGG + Intergenic
1199825716 X:151497825-151497847 GTCTTGGGAGGGAAGAGTCAAGG - Intergenic
1199871820 X:151904923-151904945 GTCTTGGGAGGGAAGAGTCAGGG + Intergenic
1202373814 Y:24215435-24215457 GTCTTGGCTGGCCAGGGTCCTGG - Intergenic
1202496967 Y:25454685-25454707 GTCTTGGCTGGCCAGGGTCCTGG + Intergenic