ID: 923624217

View in Genome Browser
Species Human (GRCh38)
Location 1:235601024-235601046
Sequence CTGAAACAGCAGCAGCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 360}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923624217_923624221 5 Left 923624217 1:235601024-235601046 CCCCATGGCTGCTGCTGTTTCAG 0: 1
1: 0
2: 1
3: 37
4: 360
Right 923624221 1:235601052-235601074 AAATGGAGCTAAATTAACTCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
923624217_923624223 15 Left 923624217 1:235601024-235601046 CCCCATGGCTGCTGCTGTTTCAG 0: 1
1: 0
2: 1
3: 37
4: 360
Right 923624223 1:235601062-235601084 AAATTAACTCTGGGTTGTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 305
923624217_923624222 6 Left 923624217 1:235601024-235601046 CCCCATGGCTGCTGCTGTTTCAG 0: 1
1: 0
2: 1
3: 37
4: 360
Right 923624222 1:235601053-235601075 AATGGAGCTAAATTAACTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 159
923624217_923624224 16 Left 923624217 1:235601024-235601046 CCCCATGGCTGCTGCTGTTTCAG 0: 1
1: 0
2: 1
3: 37
4: 360
Right 923624224 1:235601063-235601085 AATTAACTCTGGGTTGTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923624217 Original CRISPR CTGAAACAGCAGCAGCCATG GGG (reversed) Intronic
901746593 1:11377768-11377790 CTGAAGCAGCAGGATCCTTGAGG - Intergenic
902698030 1:18153538-18153560 ATAAAACAGCAGCAGCCACGGGG + Intronic
905222431 1:36457877-36457899 GTTAAACAGCAGCAGCCTGGGGG - Intronic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906258147 1:44366384-44366406 GTGAGACAGCAGCAGCACTGTGG - Intergenic
907916539 1:58874989-58875011 CTGCAACAACAGCAGCCTGGTGG - Intergenic
908186837 1:61660579-61660601 CAGAAAAAGCAGCAGCTATTTGG + Intergenic
908417479 1:63927587-63927609 CTGAACTAGCAGCAGTCCTGGGG + Intronic
909662806 1:78102846-78102868 CTGAAACAGGAAAAGCAATGTGG + Intronic
911121135 1:94297801-94297823 CTGGAACGGCTGCAGCAATGAGG + Intergenic
912871583 1:113311516-113311538 CTGGGGCAGCAGTAGCCATGGGG + Intergenic
914806809 1:150997736-150997758 CTGCAGCAGCAACAGCCACGAGG - Exonic
915440020 1:155940160-155940182 GTCACACAGGAGCAGCCATGAGG + Intergenic
916314955 1:163438730-163438752 CTGAAACAGCAGCAGCTCAGTGG - Intergenic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
917791346 1:178501131-178501153 CTCAGAGAGGAGCAGCCATGTGG - Intergenic
917922808 1:179765129-179765151 CTCCACCAGCGGCAGCCATGGGG - Intronic
918097790 1:181349056-181349078 CTCAGACAGCAGCATCCTTGGGG + Intergenic
918571490 1:185998333-185998355 CAGAAACAGAGACAGCCATGAGG - Intronic
919147342 1:193651987-193652009 ATCACTCAGCAGCAGCCATGTGG - Intergenic
919284738 1:195541972-195541994 CTGAAACACCAGCACTCTTGGGG + Intergenic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
919790670 1:201288827-201288849 CTGAAAGAGCAGCAGGATTGTGG + Intronic
919835294 1:201569115-201569137 CAGAACCACCAGCAGCCCTGAGG + Intergenic
920987750 1:210906381-210906403 CTGCCCCAGCAGCAGTCATGTGG - Intronic
922012021 1:221598415-221598437 CTGAAATAGCAGCTGTCATTAGG + Intergenic
922324653 1:224516941-224516963 CTGAAACAGAAGCAGAGCTGGGG - Intronic
922709363 1:227815713-227815735 CGGAAGCAGGGGCAGCCATGAGG - Exonic
922723753 1:227912940-227912962 CTGAAACAGGAGCATCCGTGGGG + Intergenic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923025697 1:230202239-230202261 CTCAAACAGCAGAAGACAGGTGG - Intronic
923606030 1:235443566-235443588 TGGAAACAGCAGCAGGCTTGGGG - Intronic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
923646204 1:235822871-235822893 CTGAAAGATGAGAAGCCATGTGG + Intronic
923932213 1:238713994-238714016 CTGAAATAGCTACATCCATGTGG - Intergenic
1063045048 10:2383309-2383331 CTGACACAGCACCAGCTATGGGG + Intergenic
1063079399 10:2751263-2751285 CAGAAGCAGCAGCTGCCATTTGG + Intergenic
1063854563 10:10234206-10234228 TTCAAACAGCAGCAGACATCAGG - Intergenic
1063890524 10:10623545-10623567 CTGCAGCAGGAGCTGCCATGGGG + Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1066029036 10:31398805-31398827 TTGAAAAAGCAGCAGCCAGAGGG - Intronic
1067238822 10:44473284-44473306 CTGGAAGGGCAGCAGCCCTGAGG + Intergenic
1067546668 10:47196851-47196873 CTGGAGCAGCAGCAACCACGTGG - Intergenic
1068657594 10:59591347-59591369 CAGCAGCAGCAGCAGCCATATGG - Intergenic
1069558965 10:69416318-69416340 CAGACCCAGAAGCAGCCATGGGG - Exonic
1069990167 10:72310332-72310354 CTGAATCAGCGGGAGCCTTGCGG + Intergenic
1070432846 10:76358558-76358580 CTGATAGAGCAGGAGCCAGGAGG + Intronic
1074298087 10:112209587-112209609 ATGAAGCAGCAGCAGGCAGGAGG - Intronic
1074419093 10:113293420-113293442 CTTAAAGAGGAGCAGACATGTGG - Intergenic
1074936267 10:118184616-118184638 CTGAAGCAGCAACAACCAGGAGG + Intergenic
1075485998 10:122822421-122822443 CTGAGGCAGCCGCAGCCTTGGGG + Intergenic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1076630275 10:131848257-131848279 CTGATGCTGCAGCCGCCATGAGG + Intergenic
1076696226 10:132248670-132248692 CTGGCACAGCAGGTGCCATGTGG - Intronic
1077234426 11:1473026-1473048 CTGCAACAGAAACAGCCATCAGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG + Intronic
1081212541 11:40354601-40354623 CTGGAGCAGCAGTGGCCATGAGG - Intronic
1083899684 11:65637600-65637622 TTGAAAAGGGAGCAGCCATGCGG - Intronic
1084511649 11:69609186-69609208 CTGGCACAGCAGCAGCAACGAGG + Intergenic
1086917253 11:92545117-92545139 CAGGAACAGCAACAGCCTTGGGG - Intronic
1087499697 11:98934021-98934043 CTGAAAATGGAGCAGACATGGGG + Intergenic
1088009249 11:104979348-104979370 CTGAAAGAGAAGCAGCATTGGGG + Intergenic
1088727913 11:112655880-112655902 CTGACACTGCAGCAGGCACGTGG + Intergenic
1089405358 11:118193000-118193022 CTGAGACCTCTGCAGCCATGTGG + Intergenic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1090044083 11:123315687-123315709 CTAAAACAGTGGCAGGCATGTGG + Intergenic
1090624532 11:128594398-128594420 TTGAAACAGCAAAATCCATGAGG - Intergenic
1091770604 12:3148826-3148848 CTGGGACAGCTGCAGCCGTGGGG - Intronic
1092002794 12:5045273-5045295 CTGGCAGAGCAGCAGCCAGGGGG + Exonic
1094120078 12:26963370-26963392 CTGAAATGGCAGCAGTAATGAGG + Exonic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1096757043 12:53808395-53808417 ATGAATCAGCCCCAGCCATGGGG - Intergenic
1097315437 12:58166204-58166226 CTGAGGCCTCAGCAGCCATGTGG + Intergenic
1098846598 12:75544658-75544680 CAGAAAAAGAAGCAGACATGAGG + Intergenic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1102882050 12:116493077-116493099 ATGAGTCAGCAGAAGCCATGAGG + Intergenic
1102980537 12:117237505-117237527 ATGGAACAGCAGCAGCCATTTGG + Intronic
1104231488 12:126888900-126888922 CTGGAATTGCAGCAGACATGAGG - Intergenic
1104307389 12:127621773-127621795 ATGCAACAGAAGCAGCCATGGGG - Intergenic
1104928082 12:132324037-132324059 CTGAACCAGCAGGAGCCATTTGG + Intronic
1106020346 13:25908592-25908614 CAGCAACTGTAGCAGCCATGGGG - Intronic
1106126680 13:26905633-26905655 CTGAAATAGCAGCAGTAATGAGG + Intergenic
1106254353 13:28009328-28009350 CTGAAGCAGGAGCAGCCACATGG - Intronic
1106262148 13:28077325-28077347 CTGAAACCTCCCCAGCCATGTGG - Intronic
1106541495 13:30694672-30694694 CCAAACCAGCAGCAGGCATGTGG - Intergenic
1107034554 13:35886948-35886970 CTGAAAGAGGAGTGGCCATGGGG - Intronic
1108985559 13:56582127-56582149 CTGATACAACAACAGCAATGAGG + Intergenic
1110123510 13:71912610-71912632 CTGAAACAGAAACAGCACTGAGG - Intergenic
1111665705 13:91266160-91266182 CTGAGACATCTGCAGCCCTGTGG - Intergenic
1113634270 13:111909245-111909267 CTGGCACAGCAGCAGCCAGGCGG + Intergenic
1114738057 14:25063362-25063384 GTGAAGCAGCAGCAGCTATCTGG - Intergenic
1115315284 14:32018983-32019005 CTGACAGAACACCAGCCATGGGG + Intergenic
1115418444 14:33164805-33164827 CTGACACAGGAGAAGCAATGGGG - Intronic
1116845460 14:49861158-49861180 CAGACCCAGAAGCAGCCATGGGG + Intergenic
1117460002 14:55936028-55936050 CTGAAATGGGAGCAGTCATGTGG - Intergenic
1118698719 14:68411627-68411649 CTGAGCCAGCAGCAGCTATTAGG + Intronic
1121263603 14:92584273-92584295 CTGAAGGAGCAGCACCCATCTGG + Intronic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122100182 14:99402281-99402303 GTGAACCAGCAGGAGCAATGTGG + Intronic
1124794313 15:32762306-32762328 CTGAGGCCGCACCAGCCATGTGG - Intergenic
1124801621 15:32838493-32838515 CACAAACAGCAGCAGCCGTGGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127825293 15:62697641-62697663 CTGAGAGAACACCAGCCATGTGG - Intronic
1128063239 15:64748326-64748348 CTGGGACAGCAGCGGCCAAGTGG + Intronic
1128267530 15:66279723-66279745 TTGTAACAGCAGCAGATATGTGG - Intergenic
1128272489 15:66323365-66323387 ATGAAACAGCAACAGCCTTGGGG + Intronic
1128695718 15:69760969-69760991 CTGAAACAGGAACAGCATTGAGG + Intergenic
1128964065 15:72039992-72040014 CTGAACCTGCAGCAGCAATCTGG + Intronic
1129446837 15:75625071-75625093 TTGAAACAGCAGGAGCCCGGCGG - Intronic
1130244455 15:82231931-82231953 CTGAAACACCGGAAGCCAGGAGG - Intronic
1130756123 15:86765466-86765488 CTGAAACACCAGCTGCAAAGTGG - Intronic
1131654835 15:94445128-94445150 TTGGAACAGCAGCATCCATAGGG + Intronic
1131800617 15:96065765-96065787 CTCAAACAGCAGCACGCAGGTGG + Intergenic
1132016832 15:98325153-98325175 CTGAGACAGCATCACCTATGAGG + Intergenic
1132202560 15:99964898-99964920 CTGAAAGGGCAGCAGCATTGTGG + Intergenic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132649766 16:1015182-1015204 CTGAAACACCAGCATCCCCGGGG - Intergenic
1133658349 16:7889169-7889191 GTGTAACAGCAGCAGGGATGAGG + Intergenic
1133776681 16:8901870-8901892 CGGAGACAGTAGCAGCCACGTGG - Intronic
1133952985 16:10413421-10413443 CTGAGACATCCCCAGCCATGTGG + Intronic
1134697310 16:16234057-16234079 CTGAAAAAGCAGCAAACAAGGGG - Intronic
1136518441 16:30781843-30781865 CACAGAGAGCAGCAGCCATGGGG - Exonic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1138246065 16:55468068-55468090 CTCAAACAGCAGCAGGAATGTGG + Intronic
1139422497 16:66857163-66857185 TTGCAACAGCAGCAGCTATAGGG - Intronic
1139840301 16:69873288-69873310 AGGCAACAGCAGCAGCCACGGGG - Intronic
1140065354 16:71606707-71606729 CTGACACCACAGCAGCCCTGTGG + Intergenic
1140986945 16:80167000-80167022 CAGAAACAACATCAGCCAGGAGG + Intergenic
1141036464 16:80630621-80630643 CTGTAACAGAAGCATCCCTGGGG - Intronic
1141042846 16:80687165-80687187 CTGAAACAGCAGCATTTGTGAGG + Intronic
1141252946 16:82375303-82375325 CTGTAAAAGCACCAGCCATAGGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142415414 16:89938591-89938613 CCGAGGCAGCAGCAGACATGAGG - Intergenic
1143149770 17:4800594-4800616 CTGAATGATGAGCAGCCATGTGG - Intergenic
1144112028 17:12044746-12044768 CTGAAGCAGGGGCAGCCTTGTGG - Intronic
1145192199 17:20852493-20852515 CTGAAAAAGCACAAGGCATGGGG + Intronic
1145402423 17:22552538-22552560 CTGAAAAAGCACAAGGCATGGGG + Intergenic
1147426759 17:40349486-40349508 CTGACTCACCAGCAGCCCTGAGG + Intronic
1147957951 17:44147973-44147995 GTGTAACAGCAGCAGCCTGGAGG - Exonic
1148637046 17:49156823-49156845 CAGAAGCAGCAGCAGCCAGTGGG - Intronic
1148655030 17:49276869-49276891 CTGAAACATCAGAAGCCAGGTGG - Intergenic
1149576918 17:57720585-57720607 CTGGAACTGCAGGAGCCATCTGG + Intergenic
1151170541 17:72242092-72242114 CTGAAATAGCAGCAGGGATGGGG - Intergenic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151675871 17:75597041-75597063 CTGGGACAGCAGCAGCGAAGGGG + Intergenic
1151780134 17:76240235-76240257 CTGCAGCCGCAGCGGCCATGGGG - Exonic
1152001393 17:77647687-77647709 CTGAAAGTGTAGCGGCCATGAGG - Intergenic
1153240764 18:3029522-3029544 CTGTGACAGCATCAGCTATGAGG - Intergenic
1153551941 18:6271654-6271676 TTCAAACAGAGGCAGCCATGGGG + Intronic
1153732075 18:8024382-8024404 CAGAAACACCCACAGCCATGGGG - Intronic
1154024437 18:10694264-10694286 CTCAAACAAAAGCAGCCATTAGG + Intronic
1154273417 18:12939350-12939372 CTGAAACAGCAGTTGCAATTGGG + Intergenic
1155356599 18:24959602-24959624 CTAAAGCAGCAGGTGCCATGAGG - Intergenic
1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG + Intergenic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1161486115 19:4536787-4536809 CTGATACAGCATTGGCCATGTGG - Exonic
1161668477 19:5590911-5590933 CTGAGAAAGCAGCAGCCTGGTGG - Intronic
1161694603 19:5759095-5759117 CTAAAACAGCAGCAGCACTGGGG + Exonic
1161943016 19:7417732-7417754 CAGAAGGAGCAGCAGCCACGGGG + Intronic
1162461422 19:10816311-10816333 CTGAAACCTCAGGAGCCCTGAGG + Intronic
1163175939 19:15564122-15564144 CAGCAGCAGGAGCAGCCATGGGG - Intergenic
1163636704 19:18440370-18440392 CTGACACAGGTGCAGCCCTGTGG + Intergenic
1164610739 19:29629918-29629940 CTGCAACAGCACCAGGCCTGAGG + Intergenic
1164678332 19:30117923-30117945 ATGGAACAGCAGAGGCCATGGGG - Intergenic
1165155203 19:33782637-33782659 CTGAAGCATCCCCAGCCATGTGG - Intergenic
1165391923 19:35543769-35543791 CTGTAAAAGCAGCAGCCAAGGGG + Exonic
1165393110 19:35549601-35549623 CAGAAACAACTGAAGCCATGGGG + Intergenic
1166275173 19:41748533-41748555 CTGCACCTGCAGCAGCCAGGTGG + Intronic
1166280191 19:41787329-41787351 CTGCACCTGCAGCAGCCAGGTGG + Intergenic
1166412516 19:42565612-42565634 CTGCACCTGCAGCAGCCAGGTGG - Intergenic
1166721613 19:45000324-45000346 CTGAAAGAGGGGCAGCCATTTGG - Intergenic
1167078823 19:47265451-47265473 CTCACACAGCACCTGCCATGTGG - Intronic
1167693238 19:51000146-51000168 CTGCTACAACAGCAGCGATGTGG - Exonic
925181884 2:1822741-1822763 TGGACACAGCAGCAGCCATGAGG - Intronic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
928703721 2:33925379-33925401 ATGAAAAAGCAGCATTCATGTGG - Intergenic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
930721717 2:54644572-54644594 CTGAAAAAGCAACAGGCAAGTGG + Exonic
931142839 2:59482580-59482602 CTGAAAAAGCAGAGGCCATCTGG - Intergenic
931814276 2:65885407-65885429 CTGCAACAGCAGCAACCACCTGG + Intergenic
931851120 2:66251594-66251616 CTGTAACAGGTGCAGTCATGGGG + Intergenic
932009327 2:67959599-67959621 CTGAAACAACAGAGGCCAAGTGG - Intergenic
932656018 2:73611648-73611670 CTGAAACAGAAGCTGCCCTCAGG - Intergenic
934095940 2:88604107-88604129 CTGAAACAACAGCAGAAATTGGG - Intronic
934517827 2:94999753-94999775 CAGGCACAGCAGCAGCCAGGTGG + Intergenic
935350706 2:102149828-102149850 TAGACACAGCAGGAGCCATGCGG + Intronic
935518328 2:104073098-104073120 CAGAAACAGAAAGAGCCATGGGG + Intergenic
936159082 2:110070594-110070616 CCGGAACAGCAGCAGCCAGCTGG - Intergenic
936185579 2:110300738-110300760 CCGGAACAGCAGCAGCCAGCTGG + Intergenic
936927136 2:117748919-117748941 ATGGAACAGCAGGAGCCATTGGG - Intergenic
937020063 2:118642114-118642136 CTGACACTGAAGCAGCCCTGTGG - Intergenic
937176737 2:119944129-119944151 GTGCCACATCAGCAGCCATGTGG + Intronic
937206514 2:120240107-120240129 ATGAAACAGCGGCAGTCAGGTGG + Intronic
938402492 2:131005022-131005044 CTGGAACAGCTGCAGCAAAGGGG + Intronic
942338869 2:174921647-174921669 CTGAAACCTCCCCAGCCATGCGG - Intronic
942352769 2:175070458-175070480 CTGAAATAGCAAAGGCCATGTGG - Intergenic
942611234 2:177744484-177744506 CTGAGATACCACCAGCCATGAGG + Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
945130416 2:206565614-206565636 CTGAAGCAACAGCAGCTCTGGGG - Intronic
945923451 2:215779644-215779666 TTGAAGCAGCAGCAGCAATGAGG - Intergenic
946137420 2:217658711-217658733 CTGAGAGAGCAGCAGACATGGGG - Intronic
946147296 2:217740734-217740756 CTGAAACCCCAGCAGCCAAGGGG + Intronic
948058097 2:235024425-235024447 CTGAAGCCAAAGCAGCCATGAGG - Intronic
948901400 2:240958496-240958518 CTGGCACAGGGGCAGCCATGTGG + Intronic
1169458109 20:5770375-5770397 CTAAACCAGAACCAGCCATGTGG - Intronic
1170000476 20:11608551-11608573 CTGCCAGAGCATCAGCCATGTGG - Intergenic
1170476266 20:16717889-16717911 CTGGAACTTCAGCAGCCATTTGG + Intergenic
1170677567 20:18496777-18496799 CTGAACCAGCAGCAGATACGGGG + Intronic
1170834515 20:19872224-19872246 CTGAAACCTCCTCAGCCATGAGG + Intergenic
1170959437 20:21012147-21012169 CTAAAAAAGCAGTGGCCATGTGG - Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1175270596 20:57731109-57731131 CTCAAACCCCAGCAGACATGTGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1177278943 21:18952602-18952624 CAGTAAGAGCAGCAGCCAGGTGG - Intergenic
1177634914 21:23774692-23774714 CTGAGACAGCAGTAGCGGTGGGG - Intergenic
1178966614 21:37125706-37125728 AAGAAACAGAAGCAGCAATGTGG - Intronic
1179069185 21:38055601-38055623 CTGAGAGCACAGCAGCCATGTGG + Intronic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1179959839 21:44762028-44762050 CTCAAACAGAAGCAGCCCAGTGG + Intergenic
1181273316 22:21673427-21673449 CTGGGACAGCAGGGGCCATGAGG - Intronic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1183898895 22:40990593-40990615 GGGACCCAGCAGCAGCCATGGGG + Intergenic
1184289147 22:43489080-43489102 CTGAAACACCAGGGGCCACGTGG + Intronic
1184404622 22:44292881-44292903 CTGCAGGAGCAGGAGCCATGAGG - Intronic
1185297290 22:50060690-50060712 CTGTCACAGCAGCGGCCACGTGG + Exonic
950053212 3:10007607-10007629 AAGACACAGCAGCAGCCCTGAGG + Intronic
950293399 3:11806090-11806112 CTGAGACACCCCCAGCCATGTGG + Intronic
951915407 3:27795962-27795984 CTGAAGCAGAAACAGCAATGTGG + Intergenic
952924149 3:38309059-38309081 CAGAAACAGCAGCTGCCAGTGGG - Exonic
953382902 3:42487423-42487445 CAGAAGCAGCAGTGGCCATGTGG + Intergenic
953468863 3:43149870-43149892 CTGAAACCTCTCCAGCCATGTGG - Intergenic
953589353 3:44236648-44236670 CTGAACAAACAGCAGCCATGAGG + Intergenic
954209367 3:49085975-49085997 CTGAAAAACATGCAGCCATGAGG + Intronic
954289726 3:49643238-49643260 CTGGGTCTGCAGCAGCCATGGGG + Intronic
956136892 3:66108112-66108134 CTGGAACTGCAACAGCCATCTGG + Intergenic
956745957 3:72311169-72311191 CTGAAACAGGAACATCCATGAGG + Intergenic
956833367 3:73075118-73075140 TTGCAACAGCAGCAGCCACAGGG + Intergenic
957345543 3:78956548-78956570 CTGAAACAGCACCTAGCATGTGG + Intronic
959569438 3:107867323-107867345 CTGAAATAGAAGCTGCCATTAGG - Intergenic
959785792 3:110295758-110295780 CTGAAACCTCCCCAGCCATGTGG - Intergenic
960364625 3:116756146-116756168 CTGAAACAATAGAAGCCATCTGG - Intronic
960492540 3:118334265-118334287 CTGAGGCATCACCAGCCATGTGG + Intergenic
960945182 3:122961392-122961414 CAAACACAGCAGCAACCATGTGG - Intronic
961493200 3:127270793-127270815 CTCACACAGCACCAGCCAGGTGG - Intergenic
963936871 3:151062739-151062761 CTGAAACTCCAGCAGTCATTTGG - Intergenic
964776731 3:160287372-160287394 CTGAAATAGGAGCAGTCTTGTGG + Intronic
968282190 3:197485367-197485389 CTGGAACAGCAGATGCCTTGGGG + Intergenic
969689369 4:8695856-8695878 CTTAATCAGCTGCAGCCCTGGGG + Intergenic
970705094 4:18791779-18791801 CTGGAACTGAAGCAGCCATTTGG + Intergenic
971000189 4:22313772-22313794 CTGAAACAACAACAAACATGAGG - Intergenic
972438051 4:39053888-39053910 AAGAAACAGCAGCAGCAATTGGG + Intronic
972669810 4:41204418-41204440 CAGAAACAGCAGGCTCCATGCGG + Intronic
973566145 4:52189598-52189620 CTGAAGCAGCAGCAGCCCCTGGG - Intergenic
973851183 4:54963144-54963166 CAGCAAGAGAAGCAGCCATGTGG + Intergenic
977028118 4:91846953-91846975 CTGAAATAACAGAGGCCATGTGG + Intergenic
977167013 4:93711748-93711770 ATGCCCCAGCAGCAGCCATGTGG - Intronic
977623469 4:99163955-99163977 ATGAAACAGCAGAGGCCAGGAGG - Intergenic
978350996 4:107820606-107820628 CTGAGACAGCAGCAGCTTTTGGG - Intergenic
978748250 4:112219661-112219683 CTGGAAGAGCAACAGGCATGGGG + Intergenic
979289771 4:118966575-118966597 ATGAACTAGCAGCAGCCCTGGGG - Intronic
980313483 4:131165225-131165247 CTGAAACAACAGAGGTCATGTGG + Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981724521 4:147833421-147833443 CTGAGACCTCTGCAGCCATGTGG + Intronic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984725641 4:183017748-183017770 CTGAAGCAGAACCAGCAATGTGG - Intergenic
986093749 5:4536193-4536215 CTGCACCAGCAGAAGCCAGGAGG + Intergenic
986094446 5:4540966-4540988 CTCAGACAGCAGGACCCATGTGG + Intergenic
987457305 5:18163485-18163507 CTGAGACTTCATCAGCCATGTGG - Intergenic
989358529 5:40572501-40572523 CAGAAACAGCAGCAGACCGGAGG + Intergenic
989426500 5:41302022-41302044 CTGAAAAAGCAGCAGCTTTGGGG - Intergenic
990794339 5:59523208-59523230 CTGCAAAAGCAGAAGCCCTGTGG + Intronic
992245788 5:74820946-74820968 CTGAAAATGCAGAAGCCCTGAGG - Intronic
992941100 5:81762651-81762673 CTGAATCAGCTGTAGCAATGGGG + Intergenic
993016676 5:82542628-82542650 TTGTAACAGCAACAGCCATTAGG - Intergenic
993861273 5:93139897-93139919 CTGACACAGCAGAAGCCAGATGG - Intergenic
994760057 5:103841034-103841056 CTGGACCTGAAGCAGCCATGTGG - Intergenic
995891734 5:116961374-116961396 GGGAAACACCAGCAACCATGTGG - Intergenic
996011087 5:118482676-118482698 CTGAGACCTCCGCAGCCATGTGG - Intergenic
996033131 5:118729005-118729027 CTGAAAGAGCAGAAGTCAGGGGG - Intergenic
996722663 5:126645315-126645337 CTGAAACAGTGGCAGCCAGAAGG - Intergenic
997262366 5:132474966-132474988 CTGAAAGAGGAGCAGGCAGGTGG - Intronic
997632095 5:135376533-135376555 CTGAAACAGCACCAGAGGTGAGG - Intronic
997724065 5:136105589-136105611 ATGAAGCAGCAGCAGTGATGGGG + Intergenic
998005346 5:138653251-138653273 TGGAAACAGGAGCAGCCATGGGG + Intronic
998092789 5:139380871-139380893 CTGGAACAGCGGCAGCCTGGAGG + Exonic
998619434 5:143778116-143778138 AGGAAACAGCATTAGCCATGGGG + Intergenic
999424527 5:151475745-151475767 CTGCAGCACCTGCAGCCATGAGG - Intronic
999712748 5:154332836-154332858 CTGAAGCACCAGCTGCCCTGGGG + Intronic
999870296 5:155742766-155742788 CTGAAGTAGCAGCAGTCCTGTGG - Intergenic
1000445464 5:161313670-161313692 TTGGAACAGCAGCTGCCATTTGG - Intronic
1000999679 5:167994047-167994069 CTGACAGAGCAGCAGCCTTGGGG - Intronic
1001297681 5:170510198-170510220 GGGAAGCAGCAGCAGCTATGGGG - Intronic
1003292806 6:4794364-4794386 CTGAAAGAGCTGCTGCCAAGTGG - Intronic
1003400504 6:5786746-5786768 CTGCAGCAGCAGCATCCCTGAGG - Intergenic
1003798115 6:9629247-9629269 ATCAAATAGCAGCTGCCATGAGG + Intronic
1006034974 6:31204235-31204257 CTGTAAAAGCAGCAGCCAAATGG - Intergenic
1006340356 6:33443348-33443370 CTGGCCCATCAGCAGCCATGTGG - Exonic
1006867268 6:37219008-37219030 ATGAAACAGCAGCAGTGGTGTGG - Exonic
1007328295 6:41080946-41080968 CACAAACAGCACCAGACATGAGG - Intronic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1009757191 6:67955454-67955476 CTGAGACATCCCCAGCCATGTGG + Intergenic
1011343131 6:86339762-86339784 ATTACACAGCAGCAGCCATGTGG + Intergenic
1011554404 6:88559617-88559639 CTGAAAGATCTGCAGGCATGTGG - Intergenic
1011815206 6:91181506-91181528 TGGCAATAGCAGCAGCCATGGGG + Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1013722945 6:113053139-113053161 AGGAGACAGCAGCAGCCTTGAGG + Intergenic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1014955414 6:127608974-127608996 CTGATACAGCACCAGGAATGAGG - Intergenic
1016994384 6:149951413-149951435 CATCAGCAGCAGCAGCCATGTGG + Intergenic
1017443779 6:154489137-154489159 CAGATCCAGAAGCAGCCATGTGG - Intronic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018064882 6:160117921-160117943 CTGGGACAGCAGCAGGCATGGGG - Intergenic
1019212891 6:170421000-170421022 GTGATACAGCAGCAGGCACGCGG - Intergenic
1019294554 7:266965-266987 CCCACACAGCAGCAGCCCTGGGG - Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019649933 7:2151419-2151441 CTGAAACAGCAGGAGGCCAGTGG + Intronic
1019884496 7:3892355-3892377 CTGAATGAGCAGCTGCCATCTGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1022468187 7:30665360-30665382 ATGAATCACCAGCAGGCATGTGG - Intronic
1022971707 7:35523890-35523912 CTGAAGCAGAACCAGCAATGTGG - Intergenic
1024886456 7:54147942-54147964 CTGAAACAGGGGCAGCCTTGTGG - Intergenic
1027848384 7:83416020-83416042 TTGAAAAAGCAGCAGGAATGTGG - Intronic
1028332137 7:89608004-89608026 CTGAAGCAGCTGCAGCTTTGGGG - Intergenic
1029094990 7:98077993-98078015 CTGATTCAGCAGCAGCTATAGGG - Intergenic
1029340370 7:99938834-99938856 CTGAATCAGCAGAAGCTATTTGG - Intergenic
1029799956 7:102936076-102936098 ATCCCACAGCAGCAGCCATGTGG + Intronic
1030369426 7:108681206-108681228 CTGAAACTACCCCAGCCATGTGG - Intergenic
1030379344 7:108794789-108794811 CTGAAACACCAGGAGTCATTGGG - Intergenic
1030411114 7:109181819-109181841 CTGCAGCCTCAGCAGCCATGCGG - Intergenic
1032489782 7:132315769-132315791 TTCAAATAGCAGGAGCCATGAGG + Intronic
1033298181 7:140160423-140160445 CTGAATCAGCAGCTGCCCTGGGG + Intronic
1034004421 7:147453323-147453345 CTGAGACAGCAGAAGTCATAGGG - Intronic
1035096597 7:156361127-156361149 CTAAAACAGGAGCAGCATTGAGG + Intergenic
1036086602 8:5619264-5619286 CAGAAACGAAAGCAGCCATGAGG - Intergenic
1037002853 8:13741730-13741752 TTGAAACAGCAGTAGCTATTTGG + Intergenic
1037274233 8:17160107-17160129 TTAACACAGCAGCAGCCATAAGG - Intronic
1038748388 8:30273941-30273963 CTGAGGCAGCCCCAGCCATGTGG + Intergenic
1039278976 8:35961633-35961655 CAGAAAAAGAAGAAGCCATGAGG - Intergenic
1039810883 8:41047403-41047425 CTTAATCAGAACCAGCCATGGGG - Intergenic
1039892182 8:41693202-41693224 CTGTAACAGCGGCAGAAATGGGG + Intronic
1040539606 8:48340428-48340450 AGGAAAAAGCAGCAGCCATGAGG + Intergenic
1041683557 8:60619983-60620005 CTGCAACAGTAGTAGCCTTGGGG - Intronic
1041785279 8:61625273-61625295 GTGAAATAGCAGCAGGCATCGGG + Intronic
1043423205 8:80121577-80121599 CTGAAACCTCAGGAGCCACGTGG + Intronic
1043879320 8:85524038-85524060 GGGAAAAAGCAGCAGGCATGAGG - Intergenic
1046613145 8:116447197-116447219 TTGAAACATCAGCAGTCAGGTGG - Intergenic
1046676978 8:117120497-117120519 CTGAAACAGAAGAAACCATAGGG + Intronic
1047711751 8:127559426-127559448 ATGAAACTGCAGAAGCCATCTGG + Intergenic
1047879398 8:129177041-129177063 CTGGAACTCCAGCAGCCATCTGG + Intergenic
1048021711 8:130545786-130545808 CTGACACAGCAGCAGGCACATGG - Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049065179 8:140307838-140307860 CTGGAGCTGCAGCAGCCATCTGG + Intronic
1049243143 8:141548827-141548849 CTGACCCACCAGCATCCATGAGG - Intergenic
1049743170 8:144250611-144250633 CAGAAACAGCAGCTTCCCTGTGG - Intronic
1049912627 9:284346-284368 ATGAAACAACAGGAACCATGAGG - Intronic
1050662661 9:7899929-7899951 CTTAACCAGCAGCAGCCTTTTGG - Intergenic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1052044433 9:23777957-23777979 CATAAACAGCAGCAGCCAGGTGG + Intronic
1052515222 9:29472013-29472035 AGCAAACGGCAGCAGCCATGCGG - Intergenic
1052952828 9:34227686-34227708 CTGCCACAACCGCAGCCATGAGG + Intronic
1053399993 9:37810411-37810433 CAAAAGCAGCAGCAGCAATGAGG + Intronic
1054570630 9:66806903-66806925 CTAACACACCAGCAGACATGGGG - Intergenic
1055153791 9:73036391-73036413 CTAGAACTGCAGCAGCCATATGG + Intronic
1055918366 9:81431629-81431651 CTGAAGAAGCAGCAGCTACGTGG + Intergenic
1056065105 9:82925409-82925431 CTGCATGAGGAGCAGCCATGTGG + Intergenic
1056685351 9:88754448-88754470 CTGAAACAGCAACAGGCTTCAGG + Intergenic
1057873230 9:98733567-98733589 CTGGAACAGCGGCAACCAAGAGG - Exonic
1058295223 9:103298131-103298153 CTGAAACAGAAACAGCCCTCAGG + Intergenic
1058711365 9:107682124-107682146 CTCAGAAAGCAGCAGCCAGGAGG + Intergenic
1059257058 9:112940492-112940514 CTGGAAGTGCAGCAGCCAAGGGG - Intergenic
1060240565 9:121898915-121898937 CAGCAACAGAAGCAGGCATGAGG - Intronic
1060789420 9:126476026-126476048 CTGGACCAGCAGCAGAGATGAGG - Intronic
1060822378 9:126669025-126669047 CGGAAGCAGCAGCAGGCCTGGGG + Intronic
1061868544 9:133507763-133507785 CTGAAACAGCAGGAAACAGGGGG - Intergenic
1061871935 9:133525548-133525570 CTGAAGCAGCAGCATCCACCAGG - Intronic
1186632627 X:11366517-11366539 ATGAAGGAGCAGAAGCCATGAGG + Intronic
1188483606 X:30658821-30658843 CTGACACAGCATCTGGCATGTGG + Intronic
1191902945 X:66057186-66057208 CTTACACAGCAGCAGGCAAGAGG + Intergenic
1192858615 X:75040748-75040770 CTGCAGCAGCAGGGGCCATGTGG - Intergenic
1193948150 X:87763996-87764018 CAGACACAAAAGCAGCCATGAGG - Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195809896 X:108817639-108817661 CTGAGGTAGCAGCAGCCAAGTGG - Intergenic
1197202055 X:123756869-123756891 CTGAAAGAGCAGAGGCCAGGTGG + Intergenic
1197281052 X:124536493-124536515 TTGAAACATCACTAGCCATGAGG - Intronic
1197934775 X:131729015-131729037 GTGAACCAGCAGCTGCCAGGAGG + Intergenic
1197935287 X:131734340-131734362 GTGAACCAGCAGCTGCCAGGCGG + Intergenic
1197941290 X:131793000-131793022 GTGAAGCAGCAGCTGCCAGGAGG - Intergenic
1198126309 X:133647532-133647554 GTGAAACAGCACCAGCTATAAGG + Intronic