ID: 923627219

View in Genome Browser
Species Human (GRCh38)
Location 1:235623771-235623793
Sequence CTGGGGAGACAGCATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923627219_923627222 -8 Left 923627219 1:235623771-235623793 CCCTCATCATGCTGTCTCCCCAG 0: 1
1: 0
2: 4
3: 42
4: 394
Right 923627222 1:235623786-235623808 CTCCCCAGCAACCAGCAGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 310
923627219_923627221 -9 Left 923627219 1:235623771-235623793 CCCTCATCATGCTGTCTCCCCAG 0: 1
1: 0
2: 4
3: 42
4: 394
Right 923627221 1:235623785-235623807 TCTCCCCAGCAACCAGCAGCTGG 0: 1
1: 0
2: 2
3: 44
4: 363
923627219_923627227 -3 Left 923627219 1:235623771-235623793 CCCTCATCATGCTGTCTCCCCAG 0: 1
1: 0
2: 4
3: 42
4: 394
Right 923627227 1:235623791-235623813 CAGCAACCAGCAGCTGGGGTAGG 0: 1
1: 0
2: 1
3: 39
4: 362
923627219_923627223 -7 Left 923627219 1:235623771-235623793 CCCTCATCATGCTGTCTCCCCAG 0: 1
1: 0
2: 4
3: 42
4: 394
Right 923627223 1:235623787-235623809 TCCCCAGCAACCAGCAGCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923627219 Original CRISPR CTGGGGAGACAGCATGATGA GGG (reversed) Intronic
900666395 1:3818145-3818167 CTGGGGAGGAAGCCTGACGAGGG - Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
901133957 1:6980776-6980798 CTGGGGAGGCCTCATGATCATGG - Intronic
901688860 1:10959753-10959775 CTGGGGAGGCTGCATGGTGGTGG - Intronic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902572652 1:17356594-17356616 CTAGGGAGACTGCATGAACAGGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902685113 1:18071495-18071517 CTGGAGAGACAGTATGCTGTAGG - Intergenic
903553159 1:24172862-24172884 GTGAGGACACAGCAAGATGACGG - Intronic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
903846811 1:26283787-26283809 GCGAGGAGACAGAATGATGAGGG + Intronic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904505862 1:30953262-30953284 CTGGGGATAGAGCATAATTATGG - Intronic
905771305 1:40639716-40639738 CTGGGGAGAAAGCATGTTCCTGG - Intronic
907047235 1:51306724-51306746 CTGGGCTGACAGCATTTTGAAGG + Intronic
907336342 1:53702237-53702259 CTGGAGAGGCAGCCTGGTGAGGG - Intronic
907360922 1:53914023-53914045 CTGGAGGTAAAGCATGATGAAGG - Intergenic
908319417 1:62965755-62965777 CAGGGGATACACCATGTTGAAGG - Intergenic
915766815 1:158371522-158371544 CTGGGCAGCCAGCATGGTAAGGG - Intergenic
917639353 1:176968105-176968127 ATGGGGTTACAGAATGATGAAGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
919281499 1:195495592-195495614 CTGGGGAGCCAGTGTGATTATGG + Intergenic
920377637 1:205517773-205517795 CAGGGGAGAGAGCTTGATGGTGG - Intronic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
922668250 1:227490788-227490810 CATGGGAGACAGCATGAAGCAGG - Intergenic
922938634 1:229440849-229440871 CGGGGGAGACGGCCTGATGCTGG + Intergenic
922972178 1:229751846-229751868 CTGGTTTAACAGCATGATGATGG + Intergenic
923079577 1:230640985-230641007 CAGAGGAGACAGGTTGATGATGG + Intergenic
923163564 1:231338334-231338356 CTGGGGAGCCAGCCTGACGCCGG + Exonic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
924189687 1:241537676-241537698 CTGGGGAGGTCTCATGATGATGG + Intronic
1062933124 10:1365490-1365512 GTAGGGAGAAGGCATGATGATGG + Intronic
1065723755 10:28650651-28650673 CGGGGCAGACAGCATCCTGAGGG - Intergenic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1067237074 10:44460086-44460108 CTGGGGAGAGAGCATGAGGCTGG - Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1068003987 10:51371114-51371136 CTTTGGAGACAGCCTGATAAGGG + Intronic
1068011413 10:51456069-51456091 CTGGGGAGGCCCCATGATCATGG + Intronic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068328962 10:55536626-55536648 CTGGGGAGAGAAAATGCTGAAGG + Intronic
1069138713 10:64797588-64797610 CTGGGGAGGCCTCATGATCATGG - Intergenic
1069424659 10:68278920-68278942 CTGGGGAGGCCTCATGATCATGG - Intergenic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069780647 10:70953292-70953314 ATGGGGAGAGGGCATGGTGATGG - Intergenic
1070105586 10:73427769-73427791 CTGCAGAGACAGCATGGAGAAGG + Intronic
1072444370 10:95485557-95485579 ATAAGGAGACAGCAGGATGAGGG + Intronic
1074215949 10:111383825-111383847 CTGGGGAGACCTCATGATCATGG - Intergenic
1074574061 10:114651877-114651899 CTGGGGACCCAGCATGCTGGAGG + Intronic
1074766105 10:116701060-116701082 CTCGGGAGTCAGCAAGATGGTGG + Exonic
1075055587 10:119215955-119215977 CTGGGAAGACATCAGGAAGAAGG + Intronic
1075660065 10:124187247-124187269 CTGTGGAGACAGCATCTGGAGGG - Intergenic
1076799981 10:132816871-132816893 CTGAGGCCACAGCGTGATGAGGG - Intronic
1076863038 10:133150988-133151010 CTGGGGAGGCCGCAGGATGGCGG - Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1077979889 11:7288974-7288996 CTGGTGATACAGGATGCTGATGG + Intronic
1078009830 11:7564328-7564350 CTGGGTAGAGTGCATGATGCTGG + Intronic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1079181801 11:18200559-18200581 CTGGGGAGGCCTCATGATCATGG + Intronic
1079182071 11:18202507-18202529 CTGGGGAGGCCTCATGATCATGG + Intronic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080904140 11:36523410-36523432 CTGGGGAGGCCTCATGATCATGG - Intronic
1081277053 11:41163147-41163169 CTGGGGAGACATCAGAATCATGG - Intronic
1081285046 11:41257697-41257719 CTGGGGAGACAATAAGATGTAGG + Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083961587 11:66017587-66017609 CTGACTACACAGCATGATGAAGG - Intronic
1084134022 11:67161255-67161277 CTGTGATGACAGCATGATCATGG + Intronic
1084235038 11:67782281-67782303 CTGGGGAGGCCTCATGATTATGG - Intergenic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085444149 11:76589562-76589584 CTGGGGATACAGCGTGACAAAGG + Intergenic
1085586468 11:77712332-77712354 CTGGGGAGACCTCATAATCATGG - Intronic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1087353315 11:97060660-97060682 CTGGGCAGCCAGCATGTTGTGGG - Intergenic
1087604457 11:100360129-100360151 CTGGGTATACTGCATGATGCTGG + Intergenic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091037295 11:132245542-132245564 CTGAGGAGAGAGCACGATGGAGG + Intronic
1091068109 11:132536139-132536161 CTGGAGGGACAGGATGCTGAGGG - Intronic
1093188172 12:16045677-16045699 CTGGTGTGCCATCATGATGAAGG - Intergenic
1094282592 12:28755969-28755991 CTGGGGAGGCGCCATGATCATGG + Intergenic
1097318693 12:58201704-58201726 CTGCAGAGACAGCATCAAGAGGG + Intergenic
1097335797 12:58381878-58381900 CTTGGGAGACATAATAATGATGG - Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098489435 12:71058431-71058453 CTGGGGAGGCCTCATGATCATGG - Intronic
1098530986 12:71541677-71541699 GTGAGGATAAAGCATGATGATGG - Intronic
1099400068 12:82193097-82193119 CTGGGGAGACACAATCATGGTGG - Intergenic
1099768935 12:87027962-87027984 CTGGGGAGACCGCACAATCATGG + Intergenic
1101076013 12:101130567-101130589 CTGGGGAGGCCTCATGATCATGG + Intergenic
1102231258 12:111264032-111264054 CTGATGTGACAACATGATGAAGG - Intronic
1102553951 12:113713584-113713606 CTGGGGAGGCCTCATGATCATGG + Intergenic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1104486082 12:129152148-129152170 CTGGGATTACAGCATGATTATGG + Intronic
1105041670 12:132966162-132966184 CTGGGAAGCCTGCATGATTAGGG + Intergenic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1105634492 13:22204135-22204157 TTGGGGAGAGAGCAGGATGAGGG + Intergenic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107912957 13:45122962-45122984 CTGGGAAGACATCATAAAGAAGG + Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108666001 13:52631260-52631282 CTGGGGAAACAGGCTGATGGAGG - Intergenic
1109854402 13:68108341-68108363 CTGGGGAGGCCTCACGATGATGG + Intergenic
1109906085 13:68844390-68844412 CTGGGGAGGCCTCATGATCATGG - Intergenic
1110079913 13:71296696-71296718 CTGGGATGACCACATGATGATGG + Intergenic
1110616619 13:77548811-77548833 CTGGGGAGACCTCACAATGATGG - Intronic
1111925001 13:94453800-94453822 CTGGGGAGACCTCACGATCATGG - Intronic
1113432089 13:110260180-110260202 CTGGGGAGACCTCATAATCATGG + Intronic
1114138986 14:19889991-19890013 CTGTACAGACAGCATGATGCTGG + Intergenic
1116275124 14:42823424-42823446 CTGGGGAGACCTCACGATCATGG - Intergenic
1116986077 14:51221933-51221955 CTGGGGAGACCTCATAATCATGG + Intergenic
1117404175 14:55385672-55385694 CTGGGGAGGCAGCGAGGTGAGGG - Intronic
1117894576 14:60469225-60469247 CTGAGGAGAGAACATGAGGAAGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118492387 14:66273764-66273786 CTGTAGAGACTGCATGAAGAGGG + Intergenic
1118543117 14:66853484-66853506 CTGGGGAGACCTCACAATGATGG + Intronic
1119348092 14:73942716-73942738 CTGTGGAGAAAGGATGGTGATGG + Intronic
1119394474 14:74316147-74316169 ATGGGGAGAGAGGATGATGGTGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120485995 14:85113673-85113695 CTGGGGAGGCCTCATGATCATGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1121583110 14:95045335-95045357 CTGGGGAGACAGTGTGAACAAGG - Intergenic
1121694204 14:95899669-95899691 GTGAGGAGGCAGCATGAAGACGG - Intergenic
1122366528 14:101197912-101197934 GTGGGGAGAGAGCAGGATGGAGG - Intergenic
1122932199 14:104939136-104939158 CTGGGGAGCCAGCATCCTGAAGG - Exonic
1124088728 15:26577810-26577832 CTGGGGAGACAGCATCTTGCAGG + Intronic
1124453932 15:29822863-29822885 CTGGGCAAACAGCATGGTCACGG + Intronic
1125504549 15:40259339-40259361 CTGAGGACACAGCCTGATGCTGG + Intronic
1126195426 15:45925522-45925544 CTGGGGAGGGAGGATGATGTAGG - Intergenic
1126262922 15:46715299-46715321 TTGGGGTGACACCAGGATGAAGG + Intergenic
1127576105 15:60294282-60294304 CTGGGGAGACCTCAGGATCATGG + Intergenic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1129243681 15:74267276-74267298 CTTGGGAGACAGCATGACTTGGG - Intronic
1129794014 15:78362341-78362363 CTGGATAGACAACATGGTGAGGG - Intergenic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1130863022 15:87908265-87908287 ATGGGGAGACAGCATGGTGGGGG - Intronic
1131424719 15:92336173-92336195 CTGGGGATACAGCAATATAAAGG - Intergenic
1132891683 16:2207900-2207922 CTAGAGAGACAGCATGACAAAGG - Intronic
1133044876 16:3082177-3082199 CAGGGGAGATACCATGATCACGG + Intronic
1133734858 16:8607334-8607356 CAGGGGAGGCAGCGTGATGTGGG - Intergenic
1134059940 16:11193189-11193211 CAGGGAAGACAAAATGATGATGG - Intergenic
1134285430 16:12857588-12857610 CTGGGGAGGCCTCATGATCATGG + Intergenic
1138198335 16:55070790-55070812 CTGGGGAGACCTCACGATCATGG + Intergenic
1138437662 16:57014126-57014148 CTTGGGAAACATCATCATGATGG + Intronic
1138606541 16:58093762-58093784 CTGGGGAGAGAACGGGATGAGGG - Intergenic
1138742826 16:59330740-59330762 CTGGGGAGACCTCATAATCATGG + Intergenic
1139350466 16:66331836-66331858 CTGGGGAGGCCTCATGATCATGG - Intergenic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1139684522 16:68592461-68592483 CTGGGGAGGCCTCATGATCATGG - Intergenic
1140273535 16:73487449-73487471 CTGGAGTGCCAGCATGATTATGG + Intergenic
1141588284 16:85049707-85049729 CTGGGCAGGAAGCATGATGCTGG - Intronic
1141749477 16:85948548-85948570 CTGGGGAGCCAGCCTGATCCAGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142934417 17:3316076-3316098 CTGGGGGGACAGGTTGTTGATGG - Intergenic
1143630022 17:8133665-8133687 CTGGGGAGACTTCACAATGAGGG - Intergenic
1144876844 17:18401589-18401611 CTGGGGAGATAGCAAGAGAAAGG - Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145155386 17:20542829-20542851 CTGGGGAGATAGCAAGAGAAAGG + Intergenic
1146477668 17:33176168-33176190 CTGGGCAGACAGCATCCTGTGGG + Intronic
1146551150 17:33781419-33781441 CTGGGGACAGCGCAGGATGATGG + Intronic
1147043474 17:37735631-37735653 CTGGGGAGACTAAATGATGAGGG - Intronic
1148141697 17:45333644-45333666 GTGGGCAGACAGCTTGATGCTGG - Intergenic
1148801319 17:50228243-50228265 CTGGGGAGGCATCATAATCATGG - Intergenic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149132659 17:53323941-53323963 CTGAGGAGACAACAGGAAGAAGG + Intergenic
1149602579 17:57902959-57902981 GTGGGGTGACAACATGGTGAGGG - Intronic
1150476824 17:65481987-65482009 CTGGGGAGACCTCATAATCATGG - Intergenic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152465159 17:80462150-80462172 CTGGGGAGACAGCCTGACCTTGG + Intergenic
1153097023 18:1418622-1418644 CTGGGGAGGCCTCATGATCATGG - Intergenic
1154143873 18:11850008-11850030 CTGGGGAGGCTCCATGGTGAAGG + Intronic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1155546494 18:26921308-26921330 CTGGGGAGATAACCTCATGAGGG + Intronic
1155584832 18:27352975-27352997 ATGGGGAGGCAGCCTGATCACGG + Intergenic
1155701368 18:28748043-28748065 GTGGGGAGACAGCAAGAAAATGG + Intergenic
1156723689 18:40101778-40101800 GTGAGGACACAGCATGATGCTGG - Intergenic
1157443891 18:47730652-47730674 CTGGGCAGGAGGCATGATGAGGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1159922445 18:74238009-74238031 CTGGGGATACATGATGATCAAGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1160599981 18:80005155-80005177 CTGGGGGAACAGCATGCAGAGGG + Intronic
1161362112 19:3856204-3856226 CGGGGAAGCCAGCAGGATGAAGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161888255 19:7013468-7013490 CTGGGGAAACGGCATGTTGTCGG - Intergenic
1162080070 19:8212489-8212511 CTTGGGAGACAGCAGAAAGAGGG + Intronic
1162833331 19:13300331-13300353 CTGGGGATACAGCATTAACAAGG - Intronic
1163354438 19:16800682-16800704 CTGGGGACACATCAAGAAGATGG - Intronic
1163534482 19:17869308-17869330 CTGGGGACACAGCATGATCCAGG - Intergenic
1164571671 19:29379300-29379322 CTGAGGATCAAGCATGATGATGG + Intergenic
1164579183 19:29424004-29424026 CTGGGGAGACCTCATAATCATGG - Intergenic
1164822712 19:31263083-31263105 CAGGGCAGACAGCATCGTGAAGG + Intergenic
1165121838 19:33564932-33564954 CAGGGGAGGCAGCATGGTGTGGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165743394 19:38216784-38216806 CTTGGTAGACAGCTTGAGGAAGG + Intronic
1166104539 19:40590804-40590826 CTGGGGAGACAGCCCCATGAGGG - Exonic
1166227606 19:41406333-41406355 CAGGGGAGACGGCATGCTGATGG - Intronic
1166376629 19:42331091-42331113 CTGGTGAGACAGGATGAGGCCGG + Intronic
1167093018 19:47357784-47357806 CTGGGGAGGCTGCAGGCTGACGG - Intronic
1167096905 19:47379526-47379548 CTGGGGATACGGCATGAACAAGG - Intronic
1167298054 19:48663433-48663455 CTGGGGAGACAGACAGCTGAAGG - Intronic
1168111854 19:54196869-54196891 CTGGGGATACTGCATGAACAAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925771327 2:7285449-7285471 CTGGGTAGAAAGGATGTTGATGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
927127160 2:20022427-20022449 CTGGGGAGCCTGCATAATGATGG + Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927866076 2:26588449-26588471 GTTGGGAGACAGCAAGAAGAAGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928804226 2:35131594-35131616 CTGGGGAGTCATCACAATGATGG + Intergenic
931097318 2:58955699-58955721 CTGGGCAGTATGCATGATGAGGG + Intergenic
931198530 2:60075318-60075340 CTGGGGAGAAAGCATCCTGCAGG - Intergenic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931967245 2:67547339-67547361 CTGGGGAGGCCTCATAATGATGG + Intergenic
933139273 2:78773840-78773862 CTGAGGAGACCTCATGATCATGG - Intergenic
933552846 2:83795959-83795981 CTGCAGTGACAGCTTGATGAAGG - Intergenic
934985471 2:98881784-98881806 CTGGGCACACAGCATCATGGCGG + Intronic
935394108 2:102587444-102587466 CTGGGGAGAGAGTAGAATGATGG + Intergenic
935460046 2:103319350-103319372 CTGGAGAGCCAGCCTTATGAGGG - Intergenic
936867117 2:117087527-117087549 TTGGGGAGTCAGCATGATGAGGG - Intergenic
937525301 2:122761062-122761084 CTGGGGAGGCCTCATAATGATGG - Intergenic
938378793 2:130825310-130825332 ATGGGCAGACAGCATGAGGGAGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939360826 2:141170352-141170374 CTGTGGAGAAAGCATGGTTATGG + Intronic
939667681 2:144970522-144970544 CTAGGGAGGCATCATGATCATGG + Intergenic
940040243 2:149352367-149352389 CTGGGGAGAGAGAATGATTTAGG + Intronic
940712305 2:157176889-157176911 CTGGGGAGACATCACAATCATGG - Intergenic
944046699 2:195419951-195419973 CAGAGGAGACAGGATAATGATGG - Intergenic
944156075 2:196609146-196609168 CTGGGGAGGCCTCATGATCATGG - Intergenic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
946793067 2:223320995-223321017 ATGAGGAGACAACATGATGAAGG + Intergenic
946875457 2:224125536-224125558 CTGGGGAGGCTTCATGATCATGG + Intergenic
1169357764 20:4922360-4922382 AAGCGGAGACAGCAGGATGAAGG + Intronic
1171937364 20:31287708-31287730 CAGGAGAGACATCATGATGAGGG - Intergenic
1172376617 20:34447204-34447226 GCGGGGGGACAGGATGATGAAGG - Intronic
1172964566 20:38825273-38825295 GTGGGGAGACAGCATGCTGTTGG - Intronic
1172977449 20:38917754-38917776 CTGGGGAGATACTATGTTGAAGG - Intronic
1173776951 20:45716568-45716590 CTTGTGAGACAGCATACTGATGG - Intergenic
1173825088 20:46043128-46043150 GTGGGGAGACAGAATGCTCAGGG - Intronic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174276444 20:49407921-49407943 GTGGGGAGAAAGCATGGTGACGG - Intronic
1174924726 20:54746594-54746616 TTGGGGAAACAGGATGATTATGG - Intergenic
1175801260 20:61802230-61802252 CTGGGAACAGAGCATGATCAGGG - Intronic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1181980190 22:26760621-26760643 CTGTGGACACAGCATGGTGTTGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182919176 22:34063959-34063981 TTGGGGAGAGAACAGGATGAAGG - Intergenic
1183334943 22:37241188-37241210 CTGGGGACAAGGCATGCTGAGGG - Intronic
1183726707 22:39594003-39594025 CTGGGGAGACACACTGAAGATGG + Intronic
1184515199 22:44957457-44957479 CTCTGGAGGCAGCATGAGGACGG - Intronic
1184588162 22:45461769-45461791 CCAGGGAGCCAGCATGATGGTGG + Intergenic
1185238138 22:49726420-49726442 CTGGGGAGTCTGCATGAAGCTGG - Intergenic
949344787 3:3066818-3066840 CTGGGGAGACTGGAGGGTGAAGG - Intronic
949413612 3:3793583-3793605 CTGGGGAGACCTCATAATCATGG - Intronic
949650579 3:6154429-6154451 CTGCAGAGACAGCATTATAAAGG + Intergenic
951134953 3:19094521-19094543 CTGGGGAGCCCTCATGATCATGG - Intergenic
951455102 3:22882963-22882985 CTGGGGAGGCCGCATAATCATGG + Intergenic
952678348 3:36060596-36060618 CTGGGGTGACATCAGGAGGATGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
954369906 3:50164746-50164768 CTGTGGAAGCAGCATCATGAGGG + Intronic
954642106 3:52106847-52106869 CTGGGGAGTCAGCAGATTGATGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955610392 3:60750613-60750635 CTGGAGAGACCTCATGATCATGG - Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
958082703 3:88767498-88767520 CCAGGGAGAAAGCATGAAGAAGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
961884680 3:130088810-130088832 CTGGGGAGGCCTCATGATTATGG - Intronic
962304626 3:134274565-134274587 CTGGGAAGACCTCATGATCATGG - Intergenic
962984189 3:140519724-140519746 TTGGGAAGACAGCATACTGATGG + Intronic
964503732 3:157376108-157376130 ATAGGGAGAGAGGATGATGATGG - Intronic
965202271 3:165674937-165674959 CTGGGGAGGCCTCATGATCATGG - Intergenic
967041087 3:185692859-185692881 CTGTGGAGCCAGTGTGATGAGGG - Intronic
967130289 3:186464545-186464567 CTGGGGACAAAGCATGTAGATGG + Intergenic
967675507 3:192294169-192294191 CTGGGGAGGCCTCATGATCATGG - Intronic
967894137 3:194383281-194383303 CTGGGGAGACAGGATGAATGAGG - Intergenic
968568169 4:1325955-1325977 CTAGGGACACAGGGTGATGAGGG + Intronic
968743068 4:2340957-2340979 CTGGGGAGTCCGCATGGTGGGGG + Intronic
970217897 4:13778755-13778777 CTGGGGAGACCTCAGGATCATGG + Intergenic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
970938017 4:21597326-21597348 CTGGGGAGGCCTCATGATCATGG - Intronic
971624614 4:28902584-28902606 TTTAGGAGACAGAATGATGAGGG + Intergenic
971792517 4:31186782-31186804 CTGGGGAGACCTAATGATCATGG + Intergenic
972062699 4:34897224-34897246 CTGGGGAGGCCTCATGATCATGG - Intergenic
972137500 4:35909574-35909596 CTGGGGAGACCTCATGATCATGG - Intergenic
972169826 4:36332458-36332480 CTGGGAAGGCACTATGATGATGG + Intronic
972640424 4:40920292-40920314 CTGGGGAGACCTCACAATGATGG - Intronic
973006130 4:45008844-45008866 CTGGGGAGCTAGCGTGGTGAGGG - Intergenic
973598191 4:52513811-52513833 CTGGGGAGGCCTCATGATCATGG - Intergenic
974184037 4:58422739-58422761 CTGGGGAGGCCTCATGATTACGG + Intergenic
974195381 4:58567759-58567781 CTGGGGAGATAGCACCATAAAGG - Intergenic
976010142 4:80476853-80476875 CTGGGGAGACAGTATCCTTAAGG - Intronic
976382318 4:84413666-84413688 CTGGGAAGACAGCATGAAGAGGG + Intergenic
976668570 4:87627004-87627026 CTGGGGAGGCCCCATGATCATGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978894703 4:113872975-113872997 CTTGTGAGCCAGCATGATGGCGG + Intergenic
978921565 4:114189704-114189726 CTGGGGAGACCTCATGATCATGG + Intergenic
981218147 4:142196510-142196532 CTGGTGAGATATAATGATGAGGG - Intronic
981551761 4:145948646-145948668 CTGGGGATAGAGCCTGAAGAAGG - Intergenic
981864986 4:149406903-149406925 CTGGGGAGGCCTCATGATCATGG + Intergenic
981865000 4:149406988-149407010 CTGGGGAGGCCTCATGATCATGG + Intergenic
982112125 4:152066347-152066369 CAGAGGAGACAGCATGAACAAGG - Intergenic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982719123 4:158841151-158841173 CTGGGGAGACAACAGGGTGGGGG + Intronic
984932649 4:184860617-184860639 GTCGGGAGACAGCAGGATGGCGG + Intergenic
985009649 4:185569254-185569276 CTGGGGAGACTGCCTGAAGAGGG + Intergenic
986455152 5:7911369-7911391 CTGGGGAGGCCTCATGATCATGG + Intergenic
986674277 5:10169423-10169445 CTGGATAGACAGCATGGTTAGGG - Intergenic
987207154 5:15639522-15639544 CTGGGGAGGCCTCATGATCATGG - Intronic
987313981 5:16707168-16707190 CTGGGGAGGCCTCATGATCATGG - Intronic
988804644 5:34728626-34728648 CTGGGGAGACATCACAATCATGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989006342 5:36817364-36817386 CTGGGGAGACCTCACGATCATGG + Intergenic
989170374 5:38466939-38466961 CTGTGGGGAGAGCATGTTGAAGG + Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991038702 5:62154271-62154293 CTGGGGAGACCTCATAATCATGG + Intergenic
991273834 5:64819634-64819656 CTGGGGAGGCCTCATGATCATGG - Intronic
992347532 5:75895503-75895525 TTGGGGAGGAAGCATGATGGTGG + Intergenic
994770447 5:103974388-103974410 CTGGGCAGCCAGCATGGTGTGGG - Intergenic
996768174 5:127056409-127056431 CTGGGGAGGCCTCATAATGATGG + Intronic
997447853 5:133954652-133954674 CTGTGGAGGGAGCATGATGCTGG - Intergenic
998140425 5:139696925-139696947 CAGGGGAGGGTGCATGATGAGGG + Intergenic
1001774595 5:174319769-174319791 CTCAGGAGACAGCATGATCAAGG + Intergenic
1002207679 5:177574874-177574896 CTGGGGAGGAAGGATGATTAGGG - Intergenic
1004568445 6:16821671-16821693 GTAGGGACACAGAATGATGATGG + Intergenic
1004744466 6:18496343-18496365 CGGGGGAGAAAGCATCATTAAGG - Intergenic
1005153479 6:22778482-22778504 CTGGGGAGGCCTCATGATCATGG - Intergenic
1006727317 6:36209106-36209128 GTTTAGAGACAGCATGATGAAGG - Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1006985181 6:38171253-38171275 CTGGGGCGACAGCATAATACTGG + Exonic
1007119799 6:39370429-39370451 AGAGGGAGACAGCTTGATGAAGG - Intronic
1007169673 6:39853735-39853757 CTGGGATGACAGCACCATGAGGG - Intronic
1007958116 6:45935395-45935417 CTGGGTAGAGAGCATGATTAAGG + Intronic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1011750904 6:90453761-90453783 GTGGGGATGCAACATGATGAGGG + Intergenic
1011783692 6:90819503-90819525 CTGGGACGACAGCATGAGGCTGG - Intergenic
1012005552 6:93708693-93708715 CTGGGGAGACATCAAAATCATGG - Intergenic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1013076895 6:106779788-106779810 CTGGGGAGGCCTCATGATCATGG - Intergenic
1013149202 6:107427316-107427338 CTGGGGAGGCCTCATGATCATGG - Intronic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1013713762 6:112933202-112933224 CTGGGGAGGCCTCATGATCATGG - Intergenic
1014334763 6:120119746-120119768 CTGGGTATACTGCATGATGGAGG + Intergenic
1014781391 6:125568974-125568996 CTGGGGAGACCTCATAATCATGG - Intergenic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014980638 6:127942609-127942631 CTGGGGAGGCCTCATGATCACGG + Intergenic
1015311184 6:131768721-131768743 CTGTAGAGAAAGCATGATGCTGG - Intergenic
1017377775 6:153790735-153790757 CTGGGGAGGCCTCATGATTATGG + Intergenic
1018336218 6:162792670-162792692 CTGGGGAGACAGCATCCTTAGGG + Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1019191366 6:170252960-170252982 CTTTGGAGACAGCCTGAGGAAGG - Intergenic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1019576790 7:1741448-1741470 CTGGGGAGCCTGTGTGATGAGGG - Intronic
1019612533 7:1944213-1944235 CACGGGAGACAGCAGGGTGATGG + Intronic
1020318058 7:6920821-6920843 CTGGGGAGGCCTCATGATTATGG - Intergenic
1020378802 7:7519141-7519163 CTGGGGAGACCTCATAATCATGG + Intronic
1020493666 7:8821320-8821342 CTGGGGAGACCTCATAATTATGG + Intergenic
1022022854 7:26417734-26417756 CTAGGAAGACATCAGGATGAAGG + Intergenic
1023138910 7:37081678-37081700 CTGGGGAGACCTCATAATCATGG - Intronic
1023274460 7:38503009-38503031 CAGGGCAGGCAGCGTGATGATGG + Intronic
1023557432 7:41437828-41437850 CAGGGGAGACAGCAAGATCCAGG - Intergenic
1024012619 7:45282883-45282905 CTGAGGAGACAGGATGCTGATGG - Intergenic
1024090357 7:45934684-45934706 CTTGTGAGACATCATGAAGAAGG - Intergenic
1024220885 7:47285531-47285553 CTGGGGAGGCCTCATGATCATGG - Intronic
1024480859 7:49861064-49861086 CTGTGCAGACACCATGATAAAGG - Intronic
1024947148 7:54820096-54820118 CTGGAGAGACAGCAAGATCCAGG + Intergenic
1026232544 7:68497846-68497868 CTGGGGAGGCCTCATGATCATGG - Intergenic
1026611331 7:71862515-71862537 CTGGGGAGGCCTCATGATTATGG - Intronic
1028798276 7:94930215-94930237 GTTGGGAGGCAGCATGATGGGGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029881211 7:103812232-103812254 CTGGGGAGAAAGGATGCTTAGGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1034690052 7:153007005-153007027 CTGGGGAAACACCAAAATGACGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037739052 8:21590682-21590704 GTGGGGAGACCGCAAGCTGAGGG + Intergenic
1039239946 8:35545472-35545494 CTGGAGAGGCAGCCTGCTGAGGG + Intronic
1039822739 8:41148010-41148032 CTGGGGAGACATCACAGTGAGGG - Intergenic
1039847610 8:41336849-41336871 CTTGGGAGAGAGTATGAGGAAGG - Intergenic
1041118049 8:54559797-54559819 CTATGGAGACAGTATGATAAAGG + Intergenic
1041901701 8:62989375-62989397 CTGGGGAGACATCATAATCATGG + Intronic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1044760558 8:95513548-95513570 CTGGGGAGACCTCATAATCATGG + Intergenic
1045272803 8:100676196-100676218 CTGGGGAGACAGGGTGATTGGGG + Intergenic
1045475610 8:102549912-102549934 CTGGGGAAACAATATCATGAAGG + Intergenic
1045714171 8:105022266-105022288 CTGTGCAGGCAGCATGATGCTGG + Intronic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1047196618 8:122727551-122727573 CTTGGGGGAGAGAATGATGAGGG - Intergenic
1047799236 8:128291784-128291806 CTGGGGAGACCTCATAATCATGG - Intergenic
1048223777 8:132566093-132566115 CTGGGCACACAGCATGGTGAAGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048999013 8:139813028-139813050 CTGAGAAGACAGCCTGAGGAAGG - Intronic
1049036345 8:140079174-140079196 CTGGGGAGACTTCATAATCATGG - Intronic
1049449270 8:142650655-142650677 CTGGGGAGCCCTCATGATGATGG - Intergenic
1049766516 8:144357787-144357809 CTGGGAGGACAGCGTGCTGAGGG + Intronic
1051089212 9:13386194-13386216 CTGGGGAGACTTCACGATCATGG - Intergenic
1051731483 9:20147750-20147772 TTGGGGAGACAGCATCACAAAGG + Intergenic
1052141880 9:24995908-24995930 CTGGGAAGGCAGCAGGATTAAGG + Intergenic
1053030907 9:34777263-34777285 CTGGGAAGCCAGCATGGTGAGGG + Intergenic
1054740723 9:68803543-68803565 CTTGGGAGACAGCATGAGCAGGG - Intronic
1055890302 9:81116918-81116940 CTGGGGAGACAGCAAGCTCTTGG - Intergenic
1055986962 9:82062311-82062333 ATGGGGAGACAAGATGATGTGGG + Intergenic
1055994768 9:82145550-82145572 CTAGGGAGACCGCTTGAAGAGGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056512763 9:87321345-87321367 CTGGGGAGGCCTCATGATCATGG - Intergenic
1056648234 9:88433510-88433532 CTAGGAAGACATCAAGATGATGG + Intronic
1056687798 9:88780849-88780871 CTGGGGAGAGAGCAGAGTGAGGG - Intergenic
1058705105 9:107631383-107631405 CTGGTGAGACACCATGCTGAGGG - Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060472206 9:123957437-123957459 GTGGGGAGTCAGCAGGATGGCGG - Intergenic
1060791693 9:126489656-126489678 ATGGGGAGCCAGCAGGGTGACGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061665677 9:132159896-132159918 CTGGGGTGACAGCAGGCTGAGGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1185958376 X:4518152-4518174 CTGGGGAGGCCTCATGATCATGG - Intergenic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1187214825 X:17265763-17265785 CTGGGGAGGCCTCATGATCATGG - Intergenic
1187285302 X:17898613-17898635 CTTGGGAGACACCATGACCAAGG + Intergenic
1187741158 X:22356986-22357008 CTGGGGAGGCCTCATGATGATGG - Intergenic
1188785213 X:34337103-34337125 CTGGGGAGACTGCACAATCATGG + Intergenic
1188907766 X:35808806-35808828 CTGGGGAGGCATCATGATCATGG - Intergenic
1189246538 X:39567684-39567706 CTGGGGAGGCCTCATGATCATGG + Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190501447 X:51082672-51082694 CTGGGGAAGCAACATGATGGTGG - Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1196683870 X:118495107-118495129 CTGGGGAGAGAGCATGCTTCTGG - Intergenic
1196684250 X:118496641-118496663 CTGGGGAGAGAGGGTGGTGATGG + Intronic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1199147586 X:144387557-144387579 CTGGGGAGACCTCATGATTATGG + Intergenic
1199458835 X:148060304-148060326 CTGGGGAGACCGCACAATCATGG + Intergenic
1200238878 X:154483333-154483355 CTGGGGATTCTGCATGAAGATGG - Intergenic
1200807530 Y:7447725-7447747 CTGGGGAGGCCTCATGATTATGG - Intergenic