ID: 923627856

View in Genome Browser
Species Human (GRCh38)
Location 1:235628600-235628622
Sequence CTGGTCCTGTGTAAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923627847_923627856 18 Left 923627847 1:235628559-235628581 CCAGATGATGGTGTCCTACGGGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627842_923627856 23 Left 923627842 1:235628554-235628576 CCCACCCAGATGATGGTGTCCTA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627841_923627856 24 Left 923627841 1:235628553-235628575 CCCCACCCAGATGATGGTGTCCT No data
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627843_923627856 22 Left 923627843 1:235628555-235628577 CCACCCAGATGATGGTGTCCTAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627845_923627856 19 Left 923627845 1:235628558-235628580 CCCAGATGATGGTGTCCTACGGG 0: 1
1: 0
2: 1
3: 5
4: 65
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627852_923627856 -8 Left 923627852 1:235628585-235628607 CCAGTGGACAGATACCTGGTCCT 0: 1
1: 0
2: 0
3: 9
4: 99
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627851_923627856 -7 Left 923627851 1:235628584-235628606 CCCAGTGGACAGATACCTGGTCC 0: 1
1: 0
2: 0
3: 17
4: 130
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197
923627849_923627856 4 Left 923627849 1:235628573-235628595 CCTACGGGTCACCCAGTGGACAG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923627856 Original CRISPR CTGGTCCTGTGTAAGTTCTG GGG Intronic
900192807 1:1358613-1358635 CTGGGCCTGTCTACGGTCTGGGG + Intronic
904289367 1:29474228-29474250 GTGGTCCTGTGTCTGGTCTGTGG + Intergenic
906177576 1:43788525-43788547 CTTGTCCTGTGAAGGTTCAGGGG - Intronic
906850098 1:49238884-49238906 ATGGTATTGTGTGAGTTCTGTGG - Intronic
907726112 1:57022105-57022127 CAGGTCCTGTGTAGGTGCTTGGG - Intronic
909836807 1:80265490-80265512 CTGTTCCTGTGTTAATTCTTAGG - Intergenic
909982365 1:82117766-82117788 TTGGCCCTGTGTAGGTACTGGGG + Intergenic
910531151 1:88236967-88236989 CTGCTTCTGTGAATGTTCTGTGG + Intergenic
911886795 1:103311754-103311776 CTGTTCCTGTGTTAGTTTTCTGG - Intergenic
916534063 1:165686530-165686552 CTGGCCCTGTGTGAGTTCTGGGG - Intronic
916604731 1:166329732-166329754 CTGGTCCTTTGTAGGATATGTGG + Intergenic
917132615 1:171758101-171758123 GTGTTGCTGTGTGAGTTCTGTGG + Intergenic
917919521 1:179739393-179739415 CTGGTCCTTTTTCAGATCTGTGG - Intergenic
918610889 1:186490389-186490411 CTGTCCCTGTATCAGTTCTGTGG + Intergenic
919617090 1:199821344-199821366 CTGGGCCATTGTAAGTTCTTTGG - Intergenic
922663348 1:227448817-227448839 CTGGTCCTGTTCTACTTCTGTGG - Intergenic
923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG + Intronic
924503117 1:244654664-244654686 ATGGCACTTTGTAAGTTCTGTGG + Intronic
924787470 1:247211514-247211536 CTGGCCATGTGTGAGTACTGAGG - Intergenic
1065340087 10:24696403-24696425 TTCGTCCTGTGTGAGTTTTGAGG - Intronic
1066113626 10:32220078-32220100 CTGTTCCTGTGTTAGTTCACAGG - Intergenic
1067921386 10:50461813-50461835 CTGGTCCTAAGTAAGTCCTTGGG - Intronic
1071136131 10:82456838-82456860 CTGGCCATGTCTAAGTGCTGAGG + Intronic
1071517766 10:86310385-86310407 CTGGTCTGGTGAAAGTGCTGGGG - Intronic
1074012547 10:109497408-109497430 TTGGTCCTGTTTAAGTCCTCTGG - Intergenic
1075609378 10:123839491-123839513 CTGGTCCTGGGTAAGGTCCCGGG + Intronic
1075992756 10:126851821-126851843 CAGCCCCTGTGAAAGTTCTGTGG - Intergenic
1077918026 11:6623535-6623557 CTGGTGCTGAGTAAGTTCAGTGG + Exonic
1080697730 11:34617648-34617670 CTGGTCTTGTGAAACTTATGGGG - Intergenic
1080851006 11:36070140-36070162 CTGGTGCTGAGTCAGTTGTGTGG - Intronic
1082995046 11:59247106-59247128 CTGGTTCTGTTTAGGTTGTGGGG + Intergenic
1083808664 11:65089968-65089990 CTGGGCCTCTGAAAGTGCTGGGG - Intronic
1084519708 11:69655791-69655813 CAGGTCCTGTGTCAGGGCTGGGG + Intronic
1085693975 11:78688359-78688381 CAGGTCCTGTGCAAGATATGTGG - Intronic
1085902945 11:80723708-80723730 CTGAACCTGTTTAGGTTCTGAGG + Intergenic
1087498018 11:98916108-98916130 GTGGTCTTGCGTAAGATCTGGGG + Intergenic
1090202458 11:124866168-124866190 CTGGTCCTAAGTGAGTTCTTGGG - Intronic
1090393196 11:126402791-126402813 CTGCCCTTGGGTAAGTTCTGTGG + Intronic
1090561468 11:127937269-127937291 CTTGTTCTGTGTAGGTTTTGTGG - Intergenic
1090882605 11:130847313-130847335 CTGTTTCTGTCTAAGTTGTGAGG - Intergenic
1091897034 12:4113743-4113765 GTGGTCTTGTGTGAGTTTTGTGG + Intergenic
1094028035 12:25979789-25979811 TTGGTGCTGTGTAAGTGTTGGGG + Intronic
1094252616 12:28381914-28381936 CTGGCCCTGTATCTGTTCTGGGG + Intronic
1094381044 12:29843222-29843244 ATGGTTCTGAGTAAGTGCTGTGG + Intergenic
1095096071 12:38149991-38150013 CTGCTCCTGTGTGTGTCCTGGGG + Intergenic
1097038003 12:56136811-56136833 CTGGTCCAGGATGAGTTCTGGGG - Exonic
1097876406 12:64647992-64648014 CAGGTCCTGAGGAAGTGCTGGGG + Intronic
1098594159 12:72252038-72252060 CTAGTCCTTTGTCAGTTATGTGG + Intronic
1101349162 12:103912250-103912272 CTGGTCCTGTCTGAGCCCTGGGG - Intergenic
1105542718 13:21328543-21328565 GTGCTTCTGTGTAGGTTCTGTGG - Intergenic
1106410585 13:29508521-29508543 CTGGCCCAGTGTAATTACTGCGG - Intergenic
1107389706 13:39951427-39951449 CTGATCCTGTGTAACATCTGTGG - Intergenic
1108393711 13:49972912-49972934 CAGGCCCTGTGTAGGTGCTGGGG + Intergenic
1109356772 13:61239885-61239907 CTTATCCTGTCTTAGTTCTGGGG - Intergenic
1110421193 13:75310912-75310934 CTGCTCCTGTGTTAATTCTTAGG + Intronic
1111303331 13:86373425-86373447 GTGGTCTTGGGTAAGATCTGAGG + Intergenic
1114327090 14:21600377-21600399 CTGGTCATGTGCCAGTTTTGAGG + Intergenic
1115083193 14:29482016-29482038 CTGATACTCTGTAAGTTATGTGG - Intergenic
1115716185 14:36106052-36106074 TGGGTCTTGTTTAAGTTCTGTGG - Intergenic
1117217524 14:53567408-53567430 CTGGTACTGTTTATGGTCTGAGG + Intergenic
1121437190 14:93927662-93927684 CTGGTCCTGCGTGAGAGCTGGGG + Intronic
1122884051 14:104702738-104702760 CTGGAGCTGTGAAAGTTCTGGGG - Intronic
1125612392 15:40980290-40980312 CTGGTCATGTGGAGGTTCTTGGG + Exonic
1127404179 15:58623694-58623716 CTGTTCCTGTGTTAGTTTTCTGG - Intronic
1128534063 15:68477150-68477172 CTAGTCCTTTGTCAGTTATGTGG - Intergenic
1129127565 15:73457259-73457281 CCTGTCCTGTGTGAGCTCTGGGG + Intronic
1129269440 15:74411643-74411665 CTGGACCTGTGTGAGGTCTATGG - Exonic
1129832708 15:78681220-78681242 CTGGTCCTATGTGAAGTCTGGGG + Intronic
1130371633 15:83289494-83289516 CTTGTCCAATCTAAGTTCTGTGG + Intergenic
1132367478 15:101268017-101268039 GTGGTCCTTTGCAGGTTCTGAGG - Intergenic
1132505930 16:308715-308737 CTTGTGCTGTGGAAGATCTGGGG - Intronic
1136294248 16:29292613-29292635 CTGGCGCTGGGAAAGTTCTGAGG + Intergenic
1137018834 16:35402262-35402284 CTGGTCTTGTGTGAGTGATGAGG + Intergenic
1138099384 16:54240064-54240086 CTGGTTCTGTCTAGGTTCTCTGG + Intergenic
1138530925 16:57634028-57634050 CTGGTCCTTTGAAAGGTCGGCGG - Intronic
1139926550 16:70491015-70491037 CAGGTCCAGGATAAGTTCTGAGG + Intronic
1140777137 16:78260051-78260073 ACGCTCCTGTGTAAGTTCTCTGG - Intronic
1141326365 16:83063332-83063354 CTGATGGTGTGTAACTTCTGGGG - Intronic
1142100152 16:88266659-88266681 CTGGCGCTGGGAAAGTTCTGAGG + Intergenic
1142855960 17:2730477-2730499 CAGGTCATGGGTCAGTTCTGGGG + Intergenic
1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG + Intergenic
1150761806 17:67969048-67969070 CTCGGCCTGTGAAAGTGCTGGGG - Intronic
1151360448 17:73585478-73585500 TTGGTCCTGAGTAGGTGCTGCGG + Intronic
1151543936 17:74780532-74780554 CTGGTCGTGGGACAGTTCTGTGG - Intronic
1152554820 17:81047764-81047786 CTGGGCCTGTGTGTGTGCTGTGG - Intronic
1153378777 18:4412196-4412218 CTGGTCCTGTGTTAGTGAAGAGG + Intronic
1153833131 18:8940670-8940692 CTGCTTCTGTGGAAATTCTGTGG - Intergenic
1155296986 18:24393815-24393837 GTGTTCCTGTGTAAGCACTGAGG + Intronic
1158400135 18:57114503-57114525 CTTGGCCTGTGTGAGTTATGAGG - Intergenic
1162690421 19:12425472-12425494 GTGGTCCTGTGCTAGTTTTGTGG - Intronic
1164185231 19:22860800-22860822 ATGGTACTTTGTAGGTTCTGAGG + Intergenic
1164318101 19:24112861-24112883 ATGGTACTTTGTAATTTCTGTGG - Intronic
1165010498 19:32842960-32842982 CTTGGCCTGTGTTAGTTGTGTGG + Intronic
1165360254 19:35332065-35332087 CTGCTCCTGGGTAAGGACTGTGG + Exonic
928430825 2:31217167-31217189 TTGGGCCTGGGTAATTTCTGAGG - Intronic
929554478 2:42916879-42916901 CTAGCCTTGTGTAAGATCTGTGG + Intergenic
929931852 2:46263448-46263470 TTGCTCCTGTGGGAGTTCTGTGG - Intergenic
932146406 2:69322561-69322583 CTTGTCTTGAGTTAGTTCTGAGG - Exonic
932429634 2:71666378-71666400 CTGGCCCTGTGTGCCTTCTGAGG + Intronic
933319697 2:80757913-80757935 CTGGTCCTGAGCAGCTTCTGGGG - Intergenic
933889212 2:86751119-86751141 TGGGTCTTGTTTAAGTTCTGTGG + Intronic
936544976 2:113383844-113383866 CTGGGCCTCTGAAAGTACTGTGG - Intergenic
939255681 2:139742391-139742413 CTTGTGCTGTGTCAGTTCTTGGG - Intergenic
939595610 2:144118963-144118985 CAGACCCTGAGTAAGTTCTGGGG - Intronic
939963612 2:148588717-148588739 ATGATACTGTGTCAGTTCTGAGG + Intergenic
941651153 2:168094031-168094053 GTTGTCCTGTGTAAGATATGTGG - Intronic
947314143 2:228836711-228836733 CTGCTGCTGTGTGACTTCTGAGG - Intergenic
948163058 2:235840930-235840952 CTGGTCCTGTTTGCTTTCTGGGG - Intronic
1169978196 20:11353922-11353944 CTGTTCTTGTGTTTGTTCTGAGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176167915 20:63683832-63683854 AGGGTTCTCTGTAAGTTCTGAGG + Intronic
1177208267 21:18036260-18036282 CTGGTTATGTGTCAGTTCTGGGG + Intronic
1177796951 21:25788896-25788918 CTTCTCCTGTGTATGCTCTGAGG - Intergenic
1179253151 21:39690982-39691004 TTGGTGCTTTGTAAATTCTGTGG + Intergenic
1179485135 21:41705225-41705247 CTGGTCCTTTGCATGCTCTGTGG - Intergenic
1180618381 22:17143685-17143707 CCTGACCTGTGCAAGTTCTGTGG - Intronic
1181263256 22:21613925-21613947 CTGGTACGGTGTCACTTCTGTGG + Intronic
1181519995 22:23441039-23441061 CTTGTCCTGTTTCAGATCTGAGG + Intergenic
1182466316 22:30518941-30518963 CTGGGTCTGTTTAACTTCTGAGG + Intergenic
1182615724 22:31588380-31588402 GTGGCACTGTGTGAGTTCTGAGG - Intronic
1184203598 22:42986105-42986127 CTGTTTCTGTGTTAATTCTGGGG - Intronic
951425170 3:22536213-22536235 CAGGCCTTGTGTATGTTCTGGGG + Intergenic
952694655 3:36250666-36250688 ATGCTCCTGTGTAAGTTGTCTGG - Intergenic
954804035 3:53204993-53205015 CTAACCCTGTGTGAGTTCTGAGG - Intergenic
955300920 3:57778109-57778131 CTGGACCTATTTATGTTCTGTGG + Intronic
955891701 3:63657119-63657141 CAGGCCCTGTGATAGTTCTGGGG - Intronic
956497027 3:69838875-69838897 AAGGTCATGTGTAAGTTCTGTGG + Intronic
959470011 3:106738783-106738805 CTGGTCCTGTGTAAGTCTGGAGG - Intergenic
960487064 3:118266682-118266704 GTGGTGCTGTGTAAGTTTGGGGG + Intergenic
963066333 3:141267193-141267215 TTTGTCCTGTGTACGTTCAGTGG + Intronic
964261176 3:154839154-154839176 TTGGCCCTGTGTGAGCTCTGGGG - Intergenic
966375678 3:179292956-179292978 CTGGCCCAGTGTAAGTTTTTGGG - Intergenic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
966749067 3:183304812-183304834 CAGGTACTGTTTAAGTTCTGAGG - Intronic
966831180 3:184010569-184010591 GTGGTCCTGTGAAATTTCTGGGG - Intronic
970063921 4:12069194-12069216 CTTGTCCTGTGTCAATTCTGCGG - Intergenic
971355471 4:25891044-25891066 CTGATCCTGTGGTAGCTCTGGGG - Intronic
972240176 4:37182443-37182465 CTGGTCCTTTATAAGTAGTGAGG - Intergenic
975456661 4:74598756-74598778 ATGATGCTGTGTAACTTCTGAGG - Intergenic
975850165 4:78563875-78563897 CTGTGCATGTGTAACTTCTGCGG - Intronic
977492603 4:97733698-97733720 CTGGCCCTGAATAAGTTCTAGGG - Intronic
977860611 4:101955027-101955049 ATGTTCATGTGTTAGTTCTGTGG + Intronic
978135679 4:105256204-105256226 CTGGTGCTCTTTAAGTTCTTAGG + Intronic
979393791 4:120161095-120161117 CTGGCCATGTGTGACTTCTGAGG + Intergenic
980857490 4:138456642-138456664 CTGTTCCTGTGTTAGTTTGGTGG - Intergenic
981361674 4:143852914-143852936 CTGGTCTTGTTTCAGTTCTCAGG + Intergenic
983714921 4:170769695-170769717 TTGATCCTGTTTAAATTCTGGGG + Intergenic
985947088 5:3194211-3194233 CTGGTCCTGTGGCAGCGCTGGGG + Intergenic
986535509 5:8782823-8782845 CTGTTCCTGTGTTAGTTTGGTGG + Intergenic
988135675 5:27168092-27168114 CTAGGCATGTATAAGTTCTGCGG + Intergenic
988847972 5:35148875-35148897 CAGGTACCGTGTAAGTTCTAAGG + Intronic
990727814 5:58775823-58775845 CTGGTGCTCTGTAAATGCTGTGG + Intronic
992349867 5:75917448-75917470 CTGATTCTGTGAAAGCTCTGTGG - Intergenic
993482938 5:88447673-88447695 CTGGTCCAGGGTAAGGTCTGTGG - Intergenic
995775075 5:115716320-115716342 CTGTTCCTGTGTTAGTTCACAGG + Intergenic
998746387 5:145264568-145264590 CTTGTCCTGTCGAAGTTCTCTGG - Intergenic
999543399 5:152599339-152599361 CTGGCCCTGTTGAATTTCTGAGG - Intergenic
1001276465 5:170355060-170355082 CTGGCCCAGTGTACGTTGTGTGG + Intronic
1003409287 6:5849280-5849302 GTGCTTCTGTGTAGGTTCTGTGG + Intergenic
1005090610 6:22053112-22053134 CTAGTCCTTTGTAACTTATGTGG - Intergenic
1005644043 6:27824540-27824562 TTGGTTCTGAGTCAGTTCTGGGG + Intergenic
1006165059 6:32059545-32059567 CCTGTCCTCTGTCAGTTCTGTGG + Intronic
1012315121 6:97775528-97775550 ATGGTCCTGTGTAAGGTGTCTGG - Intergenic
1012797557 6:103781861-103781883 CTGGGGGTGTGTATGTTCTGCGG - Intergenic
1015759283 6:136640762-136640784 CTCGAGCTGTGCAAGTTCTGAGG + Intronic
1019151944 6:170012313-170012335 CTGTTCCTGTGTCTGTTGTGGGG - Intergenic
1019591260 7:1835241-1835263 CTTGTCCTGTTTCAGATCTGAGG - Intronic
1020071141 7:5227690-5227712 CAGGCCCTGTGTGTGTTCTGAGG - Intronic
1020234619 7:6346214-6346236 GTGCTCCTGTGTCAGTTCAGGGG - Intronic
1020901861 7:14013599-14013621 CTTCTCCAGTGTGAGTTCTGAGG - Intergenic
1029001050 7:97154522-97154544 CTAGTCCTTTGTCAGTTATGTGG + Intronic
1029976374 7:104838275-104838297 CTAGTTCTGTGCAAGTTCTCAGG + Intronic
1030186369 7:106766028-106766050 CTGATCCTGCGGGAGTTCTGGGG - Intergenic
1033400814 7:141022718-141022740 CTTGTCCTGTGCCAGTTCTTAGG + Intergenic
1034591603 7:152144858-152144880 CTGGTGCTGTTTAAGGTGTGAGG + Exonic
1035395032 7:158529167-158529189 CAGGTGCTGTGTGAGTGCTGCGG - Intronic
1035553155 8:545049-545071 CTGGTCCTGGGGAAGGTTTGGGG - Intronic
1036080889 8:5554150-5554172 CTGGTCCTGTGGAAGCTAAGAGG + Intergenic
1036677097 8:10843400-10843422 TTGGCCCTGTGTGAGCTCTGGGG + Intergenic
1039628889 8:39086939-39086961 CTAGTCCTGTGTGAGCTGTGGGG + Intronic
1042029328 8:64458050-64458072 CTTGACCTGTGGGAGTTCTGTGG + Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1042564659 8:70099982-70100004 CTGCTCCTCTGTGATTTCTGTGG + Intergenic
1045946499 8:107802351-107802373 CTGGCCCTGGGCAAGTCCTGCGG + Intergenic
1046171688 8:110516407-110516429 CTGTTCCTGTGTTAGTTCGCTGG - Intergenic
1046210006 8:111059701-111059723 CTGGTCCTGAGAATGTTCAGAGG + Intergenic
1046694713 8:117326822-117326844 GTGGGCCTGTGTAAATGCTGTGG - Intergenic
1047178622 8:122566327-122566349 GTGGTCCTGTGTGACTTCAGAGG - Intergenic
1047280482 8:123440926-123440948 CTAGCCCTGTGGAAGTTCTGGGG + Intronic
1049247947 8:141572652-141572674 CTGGGCCTGTCTCAGTGCTGGGG + Intergenic
1051006178 9:12347696-12347718 CTGAGCCTGTATGAGTTCTGAGG - Intergenic
1054934166 9:70669045-70669067 CTGATTCTGTGCCAGTTCTGAGG + Intronic
1055717035 9:79129065-79129087 CTGGTGCTGTATTAGCTCTGTGG - Intergenic
1057726133 9:97569560-97569582 CTGTTTCTCTGTAACTTCTGTGG + Intronic
1057770279 9:97961189-97961211 ATGGTCGTGTGTATGTACTGGGG + Intergenic
1057999414 9:99849955-99849977 CTGGTCCTTTGTAAGTGCAGAGG + Intronic
1059266793 9:113040733-113040755 CTGCTCATATGTTAGTTCTGAGG + Intronic
1060550157 9:124481208-124481230 CTTTGCCTGTGTACGTTCTGGGG - Intergenic
1060973586 9:127752745-127752767 CTGGTCCTGTGCCAGGGCTGAGG + Intronic
1185523159 X:756889-756911 CTGGTCCTGGGCAGGCTCTGGGG - Intergenic
1188437669 X:30180482-30180504 CAGGCCCTGTGTGAGCTCTGAGG - Intergenic
1188524651 X:31075770-31075792 ATGGGCATGTCTAAGTTCTGAGG - Intergenic
1189133042 X:38520107-38520129 CTACTCCTGTGTAAGGTATGTGG - Intronic
1190967597 X:55315934-55315956 CTTGTCCTGTTTCAGTTCTCAGG + Intergenic
1193678835 X:84491856-84491878 CTGGTCCTCCGTGAGTTCTGAGG + Intronic
1193803225 X:85962601-85962623 CTAGTTCTGTGCTAGTTCTGTGG + Intronic
1195008174 X:100707843-100707865 CTTGTTCTGTGTTAGTCCTGAGG + Intronic
1196112039 X:111956613-111956635 CTGGTCGTGGGAAAGTTATGGGG + Intronic
1196595469 X:117540902-117540924 CTCTTCCTATGTAGGTTCTGAGG + Intergenic
1198987815 X:142476436-142476458 CTGACACTGTGTAACTTCTGAGG + Intergenic
1201765269 Y:17569088-17569110 CTGCTCCTGTGTGTGTCCTGGGG - Intergenic
1201836283 Y:18336901-18336923 CTGCTCCTGTGTGTGTCCTGGGG + Intergenic