ID: 923628736

View in Genome Browser
Species Human (GRCh38)
Location 1:235635558-235635580
Sequence ATGGGGGTGGAGCCCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923628730_923628736 -1 Left 923628730 1:235635536-235635558 CCTGGTGGGAGGCGTTTGAGTCA 0: 1
1: 48
2: 516
3: 2115
4: 7646
Right 923628736 1:235635558-235635580 ATGGGGGTGGAGCCCTCCTGAGG 0: 1
1: 0
2: 4
3: 44
4: 338
923628725_923628736 19 Left 923628725 1:235635516-235635538 CCTGATGTATGGAGGTGGGGCCT 0: 1
1: 0
2: 1
3: 25
4: 386
Right 923628736 1:235635558-235635580 ATGGGGGTGGAGCCCTCCTGAGG 0: 1
1: 0
2: 4
3: 44
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923628736 Original CRISPR ATGGGGGTGGAGCCCTCCTG AGG Intronic