ID: 923629422

View in Genome Browser
Species Human (GRCh38)
Location 1:235640134-235640156
Sequence TCCTCCCCAGGCTGAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923629422_923629428 12 Left 923629422 1:235640134-235640156 CCATGCATTCAGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 241
Right 923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
923629422_923629425 -7 Left 923629422 1:235640134-235640156 CCATGCATTCAGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 241
Right 923629425 1:235640150-235640172 GGGAGGAGACCTGGTGTTGCAGG 0: 1
1: 0
2: 2
3: 23
4: 318
923629422_923629427 9 Left 923629422 1:235640134-235640156 CCATGCATTCAGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 241
Right 923629427 1:235640166-235640188 TTGCAGGCACATCATGCTTACGG 0: 1
1: 0
2: 1
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923629422 Original CRISPR TCCTCCCCAGGCTGAATGCA TGG (reversed) Intronic
900269828 1:1781352-1781374 CCCTGCCCAGGCTGAAAGCCAGG + Intergenic
900290645 1:1922219-1922241 CCCTCCCCAGGCTGAGGGCCAGG - Exonic
900830741 1:4963560-4963582 TGCTCCCCAGTCTTACTGCAAGG + Intergenic
901316945 1:8315972-8315994 TCCTGCCCAGGCTGAAGAGAAGG - Intergenic
902808882 1:18877245-18877267 TCCTCTGCAGGCTGGAGGCAAGG + Exonic
902940688 1:19798733-19798755 CCCTCCCCAGGCTGAAGGGCAGG + Intronic
903160976 1:21488981-21489003 TCCTCCCCAGGATGGCTGCAAGG - Intergenic
904575352 1:31501895-31501917 TCCACCCTAGACTGACTGCATGG + Intergenic
904849296 1:33445268-33445290 TCCTCCGCAGGCTGGATGCACGG + Intergenic
906281146 1:44554701-44554723 TCCCCACCTGGCTGCATGCAAGG - Intronic
907324236 1:53626442-53626464 TACTCCCCAGCCTGCATCCAGGG + Intronic
910332911 1:86096589-86096611 TCCTCCTCAGCCTAAATACAAGG + Intronic
911104165 1:94117116-94117138 TCCTCCCCATGTTGATTGAATGG - Intronic
912471983 1:109912386-109912408 TGCTCCCCAGGCAGAAGCCAGGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915273873 1:154774855-154774877 GCCTTCCCAGGATGCATGCATGG - Intronic
916478445 1:165192678-165192700 CCCTCACCAGGCTGAATCCCAGG + Intergenic
916481863 1:165221430-165221452 TCCCCACCAGGGCGAATGCAAGG + Intronic
916570049 1:166017292-166017314 TCCTCCCCATGTTGACTACAGGG + Intergenic
916652595 1:166845389-166845411 TCCTCCACAGGCCCATTGCAGGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921294368 1:213688244-213688266 TTCTCCCCAAGCTCAATTCAAGG + Intergenic
922548708 1:226477929-226477951 TCCTCCCCCAGCTGAAATCAAGG - Intergenic
922684162 1:227626388-227626410 TCCTTCCCAGGATGTATCCAGGG + Intronic
923629422 1:235640134-235640156 TCCTCCCCAGGCTGAATGCATGG - Intronic
924030223 1:239878862-239878884 TCCTCCTCAGGCTGAATTAGGGG - Intronic
924854859 1:247866206-247866228 TGTTGCCCAGGCTGAGTGCAGGG + Intronic
1064020400 10:11804693-11804715 TCCTCCCCTGGCTGGATGCCGGG + Intergenic
1064739597 10:18419066-18419088 TCATCCCCAGGCAGAATTAAAGG + Intronic
1065408770 10:25398144-25398166 GCCTCACCAGGCTGAAATCAAGG - Intronic
1067529320 10:47059049-47059071 TCCCGCCCAGGCTGTGTGCAGGG - Intergenic
1067726244 10:48773442-48773464 TCCTTCCCAGGCTGGATAAAGGG - Intronic
1070403107 10:76070785-76070807 ACCTCCCCAGGATGAATGTGAGG - Intronic
1070544132 10:77439531-77439553 TTCTCCCCTGGCTCAAAGCAGGG + Intronic
1070771002 10:79082321-79082343 GCCACCCAAGGCGGAATGCAAGG - Intronic
1074870187 10:117570063-117570085 TCCTTCCCAGGCTGACTTCCTGG + Intergenic
1075071862 10:119325217-119325239 TCCTCCCAAAGCTGAAAGGAGGG - Intronic
1075220166 10:120577782-120577804 TCCTCTCCTGGCTGACTCCAAGG - Intronic
1075780478 10:125014169-125014191 CACTCCCCAAGCTGGATGCAGGG + Intronic
1075812031 10:125231377-125231399 TCCTTCAGAGGCTGAATGCCCGG - Intergenic
1075915393 10:126162208-126162230 CCCTCCCCAGGCTGACTTCTGGG - Intronic
1075948170 10:126455365-126455387 TCCTCCCCAGGGTGGGAGCAAGG + Intronic
1076648386 10:131970138-131970160 TGTTGCCCAGGCTGAGTGCAGGG - Intronic
1078619875 11:12897444-12897466 ACCTACCCAGGTTGAATGAAGGG + Intronic
1081333035 11:41827506-41827528 TGCTCCCCAGGATGATTGTAAGG + Intergenic
1081878717 11:46429297-46429319 TCCTCCCCAGGATGCGGGCAGGG - Intronic
1082850874 11:57763699-57763721 ACCTCCCCAGGCTGGAGTCAAGG - Intronic
1084572266 11:69966748-69966770 TCCTCCCCATGCTCTCTGCAGGG - Intergenic
1086277316 11:85146661-85146683 TCTTTCCCAAGCTGAATGCCTGG + Intronic
1088994598 11:114985614-114985636 ACCTCCCCAGGCTGCAGGCCAGG + Intergenic
1092261000 12:6953330-6953352 TCCTCTCCTGGCTGGAGGCAAGG - Intronic
1094452841 12:30600801-30600823 TCCTCCCCAGGTTGGCTGCAAGG - Intergenic
1094851002 12:34382314-34382336 TCCTCCCCACCGTGCATGCATGG - Intergenic
1096178548 12:49538707-49538729 TCCTCCCCCGGCGGAATGGGAGG - Intergenic
1096490745 12:52011464-52011486 TCCTGCCCATGCTGACTGCCAGG - Intronic
1096492329 12:52019527-52019549 TCCACTCCAGGCTTCATGCATGG + Intergenic
1096610837 12:52800446-52800468 TCCTCCCCAGGCAGGATTGATGG - Intergenic
1097170691 12:57111028-57111050 TCCTCCCCTGGCTGGGTGGATGG - Intronic
1100167371 12:91931301-91931323 TCTTCCCCAGGGTAAATTCAAGG + Intergenic
1101782372 12:107847118-107847140 TCCACCCCAGGCTCAATGCGAGG - Intergenic
1102025479 12:109712202-109712224 CCCTCCCCAGGCTGAAGGTGGGG - Intergenic
1103563955 12:121806165-121806187 TCCTCCCCACGCTGCAGGAAGGG - Intronic
1103739980 12:123084458-123084480 TCCTCCCAAGCCTGAATGCACGG - Intronic
1105826267 13:24126183-24126205 TCCTCTCCAGGATGAAGTCATGG + Intronic
1106898765 13:34333249-34333271 TCCTGCCCAGGCTGCTTTCATGG + Intergenic
1107169994 13:37329697-37329719 TGCTCTCCAGGCTTATTGCATGG + Intergenic
1109633723 13:65085906-65085928 TCCTCCCCAGCCTGAAGGTGGGG + Intergenic
1109929978 13:69203090-69203112 TTTTTCCAAGGCTGAATGCATGG - Intergenic
1113952326 13:114078967-114078989 CCCTCCCCAGGATGCCTGCAGGG - Intronic
1115537228 14:34384662-34384684 TCCTCCCCAGGCTGAGGGTGTGG + Intronic
1119905503 14:78298220-78298242 TCCTCCCCAGGCCCCATGCCGGG + Intronic
1121907111 14:97756787-97756809 TTCTGCCCAGGCTTAATGAACGG + Intronic
1121962923 14:98277824-98277846 TCCTCGCCAGCTTGAATGCTGGG + Intergenic
1122896050 14:104757568-104757590 TCCTGCCCATGCTGAAGCCATGG - Intronic
1124493624 15:30173475-30173497 TCCTCCCCAGCCTGGAGGCCCGG + Intergenic
1124749944 15:32365174-32365196 TCCTCCCCAGCCTGGAGGCCCGG - Intergenic
1124883725 15:33664667-33664689 TCCTCCCCAGGGTTCTTGCAAGG + Intronic
1127470300 15:59284079-59284101 TCATCCCAAGGCTGACTCCAGGG - Intronic
1128309278 15:66620462-66620484 TCCTCCCCAGGCAGAAAGGCTGG - Intronic
1129367906 15:75068270-75068292 TCCTCCCCAGGCTGAGCGAGAGG - Intronic
1129871420 15:78944221-78944243 ACCTCCCCTGGCTGAAGGCAAGG - Intronic
1130441570 15:83959898-83959920 TTCTCCCCATCCTGAATGGAAGG - Intronic
1130919937 15:88335468-88335490 TCTTCCCCAGGCAGAATGGATGG - Intergenic
1131151559 15:90050417-90050439 GCCTGCCCAGGCTGGAAGCATGG - Intronic
1132471421 16:105742-105764 TCCTCCACAGGCTGAGTGTAGGG + Intronic
1134068899 16:11248689-11248711 TGTCGCCCAGGCTGAATGCAAGG - Intergenic
1135041607 16:19121760-19121782 TGATCCCCAGCCTTAATGCATGG - Intronic
1136084474 16:27874933-27874955 CACTCCACAGGCTTAATGCATGG - Intronic
1137496219 16:48971424-48971446 TCCTTCCCTGGCTCAAAGCAAGG + Intergenic
1137887669 16:52124387-52124409 TCTTCCCCAGGTTCATTGCATGG + Intergenic
1139624883 16:68179317-68179339 TCATCCACAGGCTGAAGGCAGGG + Intronic
1140866000 16:79062707-79062729 TCCTCCTCAGGCTGAAAACCAGG - Intronic
1141308096 16:82885643-82885665 TTCTTCCCAGGATGAATGGATGG - Intronic
1142597286 17:1035781-1035803 CCCTCCCCAGGCTCTCTGCAAGG + Intronic
1144125106 17:12196033-12196055 TCTTCCCCAGGCAGATTTCAGGG + Intergenic
1149073417 17:52570925-52570947 TCCTCTCCAGCCTCACTGCATGG + Intergenic
1149466734 17:56885984-56886006 TCTTCCACATGCTGAATTCATGG + Intergenic
1149595563 17:57862690-57862712 TCCCACCCAGGCTGGGTGCAGGG + Exonic
1151214123 17:72565958-72565980 TCCTCCCCATGCTGATGGCCTGG - Intergenic
1152199074 17:78934717-78934739 TCCTCCCCAGGAGGAATCCAGGG - Intergenic
1152225350 17:79090273-79090295 TCCTCGCCAGGCTGGGGGCACGG + Intronic
1152263045 17:79277606-79277628 ACCTCCCCAGGCTCACTGCCTGG + Intronic
1152687829 17:81703412-81703434 TCCTCCCCAGCTCGAATGCCCGG + Exonic
1152728537 17:81959243-81959265 CCCTCCCCAGGGTCAAAGCAGGG - Intronic
1152879065 17:82805083-82805105 TCCTGCCAAGGGTGAGTGCAGGG - Intronic
1152889646 17:82873250-82873272 TCCTCCCCAGGATGAAGGGCAGG - Intronic
1153045963 18:856160-856182 GCCTCCCAAGCCTGAATTCAAGG + Intergenic
1156284079 18:35673723-35673745 TCCTACTCTGGCTGGATGCAGGG - Intronic
1156366911 18:36438027-36438049 TCCTCCAGAGGCTGCCTGCAGGG + Intronic
1156455695 18:37292459-37292481 TCTTCCCAAGGCTGAATGAGTGG - Intronic
1156703931 18:39857294-39857316 TCCACCCCAGGCTGATTGATAGG - Intergenic
1158475835 18:57778578-57778600 TCCTCCCAAGGCTGCAGTCAAGG + Intronic
1158523421 18:58191075-58191097 TGCCACCCAGGCTGAATGAAGGG - Intronic
1159045313 18:63364373-63364395 CCCTCCCCAGGCTAAGTGCTAGG - Intronic
1160190099 18:76708515-76708537 TGCTCCCGAGGCTGCAGGCAGGG + Intergenic
1160281136 18:77492278-77492300 TCCTGCTGAGGCTGAATTCAGGG + Intergenic
1160424665 18:78771731-78771753 ACCTGCCCAGGCAGAGTGCACGG + Intergenic
1161128897 19:2576583-2576605 CACTGCCCAGGCTGAGTGCAGGG + Intronic
1161956323 19:7497555-7497577 TCCTTCCCAGGCTGCATCCAAGG - Exonic
1162034396 19:7931492-7931514 TCCTGACCAGGCTGAAAGCTGGG - Intronic
1163870430 19:19816743-19816765 GCCTCCACAGGCTGAGTGCTGGG + Intronic
1165264368 19:34647623-34647645 TCCTTCCCTGGCTGAGTGCATGG - Intronic
1166615242 19:44238322-44238344 TGTTGCCCAGGCTGAGTGCAGGG + Intronic
1166996059 19:46720203-46720225 CCATCCCCAGGCTGGATGCTTGG + Exonic
1167231978 19:48290664-48290686 TCCACCCCCGGTTGAATCCAGGG - Intergenic
925000779 2:401266-401288 TCCTCCACAGCCTGGAGGCAGGG - Intergenic
925523726 2:4776732-4776754 TCCTTCCCTCACTGAATGCATGG + Intergenic
925632325 2:5907226-5907248 TCTTACCCAGGCTGAGTGCAGGG - Intergenic
926156244 2:10455565-10455587 GGCTCCCCAGGAGGAATGCACGG + Intergenic
926251734 2:11158868-11158890 ACCTCCCCAGGCTGCAGGGATGG + Intronic
927554648 2:24023316-24023338 TCCTGCACAGGCTGGGTGCAGGG - Intronic
931181714 2:59908368-59908390 TCCTACTCGGGCTGGATGCATGG - Intergenic
932493693 2:72136390-72136412 TCCTCCCCGAGCTGACTGCAGGG - Intronic
933990573 2:87631325-87631347 TCCTCACCAGGATGAATGACAGG + Intergenic
934097136 2:88617147-88617169 AAGTCCTCAGGCTGAATGCAGGG + Intronic
935131618 2:100265124-100265146 TCCTCCCTAGCCAGACTGCAGGG + Intergenic
935186013 2:100733659-100733681 TCATCCCCAGGATGAATTCTTGG + Intergenic
936303273 2:111319499-111319521 TCCTCACCAGGATGAATGACAGG - Intergenic
936465137 2:112741411-112741433 TCCTCCCCAGGATGACCACATGG + Intronic
937588869 2:123590271-123590293 TCCTCCCCAGGCTGAAATGAAGG - Intergenic
939541944 2:143504947-143504969 TCCTCCCCACCCTGCCTGCATGG + Intronic
939588779 2:144037438-144037460 TCCTCCCAAGTCTGGATACAAGG - Intronic
940056986 2:149524125-149524147 TCATCCCCAGGATGAAGGCTTGG - Intergenic
942084115 2:172428157-172428179 TCCTTCCCGAGCTGAATGGAGGG - Intronic
945150114 2:206781969-206781991 TCCTCCTGAGGCTGAATCCTCGG + Intronic
945585132 2:211651868-211651890 TTCTCACCAGGCTGAAATCAAGG - Intronic
945722771 2:213439084-213439106 ATCTCCCCAGGCTGAAATCAAGG - Intronic
946026487 2:216674779-216674801 TCCACCCCAGGGAGGATGCAGGG + Exonic
946645538 2:221829486-221829508 ACCTTCCCAGGCTGGCTGCAAGG + Intergenic
947523849 2:230866719-230866741 CCCTCCCCAGGCTGAGTGGAGGG - Intronic
947998246 2:234546309-234546331 TTCTCCACAGGATGAATGGAAGG + Intergenic
948079068 2:235190623-235190645 GCCTCCCCAGGCAGAACTCAAGG - Intergenic
948376807 2:237526052-237526074 CCCACCCCAGGCTGGAAGCAGGG - Intronic
1169189629 20:3649961-3649983 TTCTCCCCAGGCTGTGTGCAGGG - Exonic
1170283469 20:14678173-14678195 TTGTCTGCAGGCTGAATGCAGGG - Intronic
1171302740 20:24078019-24078041 TTCACCCCAGGCTGAAGTCATGG - Intergenic
1171350302 20:24497238-24497260 TGCTGCCCAGGCTGAGTGCAGGG + Intronic
1173339706 20:42142126-42142148 TCCTCCCCAGGCCCCATCCAAGG - Intronic
1174378117 20:50139575-50139597 TCCTCCCCAGCCTGGAAACACGG + Intronic
1174396770 20:50251416-50251438 GCGTCCCCAGGCTGGATTCAAGG + Intergenic
1175271666 20:57738421-57738443 CCCTCCCCAGGCTGAAATCAAGG + Intergenic
1175754074 20:61518235-61518257 CTCTCCACAGGCTGACTGCATGG + Intronic
1176132882 20:63503691-63503713 TCATCCCCAGGGTGCAGGCAGGG - Intergenic
1176408810 21:6436717-6436739 ACCTCCCCTGGCTGTCTGCAAGG - Intergenic
1179684303 21:43045039-43045061 ACCTCCCCTGGCTGTCTGCAAGG - Intergenic
1180953726 22:19731981-19732003 ACCTCCACAGGCTGAAGGGAGGG + Intergenic
1181844628 22:25697221-25697243 TCCTCCCCAGCCTATATGCATGG - Intronic
1182517259 22:30865897-30865919 TCCTGACCAGGCTGTCTGCATGG - Intronic
1183382736 22:37498535-37498557 CCCTCCCCAGGCTGGCAGCAGGG - Intronic
1184989017 22:48154879-48154901 TCCTACCCAGGCTGAAGGTCTGG - Intergenic
1185079465 22:48701716-48701738 TCTTCCCCATGCTGTTTGCAGGG + Intronic
1185175644 22:49325073-49325095 AACTCCCCAGCCTGACTGCACGG + Intergenic
950304714 3:11909077-11909099 TCCTCTCCAATCTAAATGCAGGG - Intergenic
950305695 3:11914199-11914221 TCCTCTCCAATCTAAATGCAGGG - Intergenic
950416446 3:12871724-12871746 TCCTCTCCAATCTAAATGCAGGG - Intronic
951294294 3:20915120-20915142 TACTCCTCAGTCTAAATGCAGGG + Intergenic
953385764 3:42504859-42504881 TCCTTCCCAGGCTGAAGTCAGGG - Intronic
953505601 3:43482911-43482933 TCCTCCCTCAGCTGACTGCAAGG - Intronic
953978164 3:47398258-47398280 TGTTGCCCAGGCTGGATGCAGGG - Intronic
954535584 3:51357166-51357188 TCCTGGCCAGGCTGGCTGCATGG - Intronic
954637533 3:52079369-52079391 TCCTCACCAGGCTGGAGACAAGG + Intronic
954686229 3:52371760-52371782 CCCTCCCCATGCAGAAAGCAGGG + Intronic
954867615 3:53743415-53743437 TCCTCCAAAGGCTGATTCCAGGG + Intronic
961409240 3:126706432-126706454 TCCCCCCCATGATGTATGCAAGG + Intronic
961497773 3:127306745-127306767 TCCGCCCCAGGCTGACTTCTAGG + Intergenic
961852472 3:129834988-129835010 TCTTACCAAGGCTGGATGCAAGG - Intronic
961869293 3:129976205-129976227 TCCTCCCCTGTCTCAATGCTGGG + Intronic
962254578 3:133861609-133861631 TCATGCCCTGGCTGAAGGCAGGG + Intronic
962344763 3:134610940-134610962 TCCTCCCAAGGATGCCTGCAGGG + Intronic
962382371 3:134908425-134908447 TCCTACCCAGGCAGCCTGCAGGG + Intronic
962436763 3:135374041-135374063 TCCTCACCAAGCTGATTGAAGGG + Intergenic
962927183 3:140005573-140005595 TCATCCCTAAACTGAATGCATGG + Intronic
963845098 3:150147465-150147487 TCCTCCCCAGGCAAAATGAGGGG + Intergenic
965614924 3:170584730-170584752 TCCTCCTCCGACTGAGTGCAGGG - Intronic
968479773 4:827912-827934 ACCTCCACAAGCTGCATGCAAGG + Intergenic
972652805 4:41035701-41035723 TCCTCACTTGGTTGAATGCATGG - Intronic
976313192 4:83633012-83633034 TCCTCCTCATTCTGACTGCAAGG - Intergenic
978880247 4:113693590-113693612 TCCATCCCAGGTGGAATGCAGGG - Intronic
979313239 4:119229054-119229076 TAATCCCCAGGCTGAATACCTGG - Intronic
983181660 4:164655936-164655958 TCCTTCCCAGGATGTATGTAGGG - Intergenic
985788777 5:1914191-1914213 TCCCCCCCAGGTTGACTCCAGGG + Intergenic
987637213 5:20559294-20559316 TCCTCCCCAGGAATAATACAAGG + Intronic
988992599 5:36686044-36686066 TCCTCCCCACCCTGCCTGCAGGG + Exonic
991501088 5:67278501-67278523 GCCTCCTCAGGCTCACTGCATGG - Intergenic
994690071 5:103006833-103006855 TCCTTCCCAGGATTAATACAGGG - Exonic
995107187 5:108387969-108387991 TTCTCACCAGGCTGAAATCAAGG - Intergenic
996706869 5:126506746-126506768 TCCTCCTCAGGCTGAGTCCACGG - Intergenic
999762806 5:154715638-154715660 TCCTCCCAAGAGTGAATGCGGGG + Intronic
1000127914 5:158265398-158265420 TCCTTCCCCAGCTGAAAGCAAGG - Intergenic
1000534089 5:162458426-162458448 TCCTCCCCAAGCTGGATGGTGGG - Intergenic
1000999731 5:167994392-167994414 TCATCCCCAGGCAGCAAGCATGG + Intronic
1002276723 5:178108736-178108758 TCCTCACCAGGATGGCTGCAGGG + Intergenic
1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG + Intronic
1002664305 5:180811058-180811080 TCCCCCTCACGCTGAATCCAGGG + Intronic
1005782855 6:29211371-29211393 TCCTCACTAGGAAGAATGCATGG + Intergenic
1007240321 6:40420206-40420228 GCCACCCCGGGGTGAATGCAGGG - Intronic
1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG + Intronic
1008159672 6:48061853-48061875 TCCTCCCCAGGGTGGAATCATGG - Intronic
1012384767 6:98667313-98667335 CCCTCGCCTGGCTGCATGCACGG - Intergenic
1012442667 6:99276010-99276032 TACTTCCCAGGCTAAATGCTGGG - Exonic
1013961909 6:115911118-115911140 TCCTCCCTAGGATTAATACAGGG - Intergenic
1016704392 6:147089888-147089910 TCCTCACCATGCTGGATGGAGGG - Intergenic
1017754797 6:157520189-157520211 TCTTCCCCAACCTGACTGCAGGG + Intronic
1018625094 6:165770620-165770642 CGCTCCCCAGGCAGAATGGAGGG - Intronic
1023528703 7:41131422-41131444 TCTTCCCCAGGCTCTATGGAAGG - Intergenic
1024529152 7:50376359-50376381 CCCACTCAAGGCTGAATGCACGG + Intronic
1028527385 7:91801235-91801257 TCCTCGTCTGGCTGAATCCAGGG + Intronic
1032511631 7:132477266-132477288 CCCTCCCCAGGCTCCAGGCAGGG + Intronic
1034463786 7:151213709-151213731 TCCTCCGCAGGCCAAATCCAGGG + Intronic
1035440367 7:158892113-158892135 TCCTCACCTGGCTGAGTGCCTGG + Intronic
1035720068 8:1784979-1785001 TCCTCCCCAGCATGAAGGAAAGG - Exonic
1036072249 8:5453992-5454014 TCCTGGCCATGCTGAATTCAGGG - Intergenic
1037625473 8:20602585-20602607 TCCTGCCATGGCTGAATTCATGG - Intergenic
1038672300 8:29592080-29592102 ACCTCCGGAGGCTGAATGGACGG - Intergenic
1040744762 8:50627967-50627989 TCCTCCCCAGGATTAAAGCATGG + Intronic
1041685014 8:60635904-60635926 TCCTCTCCAGGCTGCTTGCTGGG + Intergenic
1047961154 8:130012819-130012841 GCCTCACCAGGCTGAAAGAAAGG - Intronic
1048406701 8:134129893-134129915 CCCTGCCAAGGCTGACTGCACGG - Intergenic
1051920306 9:22257089-22257111 TCATACCCAGGCAGAATGCCAGG - Intergenic
1057302409 9:93894516-93894538 GCCTTCCCAGCCTGACTGCATGG - Intergenic
1057490094 9:95513823-95513845 CCCTCCCCAGGCTGGAGGAAAGG + Intronic
1058773172 9:108258622-108258644 TCCTCCACAGGTAGAATACATGG + Intergenic
1058899192 9:109427110-109427132 TTCCTCCCAGGCTGAATCCAGGG - Exonic
1059841994 9:118227757-118227779 TCTTCACCAGGCTGAACTCAAGG - Intergenic
1059853482 9:118368938-118368960 TCCTGCCCAGGATAAATACAGGG + Intergenic
1059993010 9:119882985-119883007 TCCTCCCAAGCCTGAGTCCAAGG + Intergenic
1060230577 9:121822505-121822527 TCCTCTGCAGGCAGAATGCCTGG + Exonic
1060418615 9:123451144-123451166 TTCTGCCCAGGCTGAATGGCCGG + Intronic
1061375628 9:130222829-130222851 TCCTGCCCAGGGTGGAAGCAGGG + Intronic
1061716859 9:132523819-132523841 TCCTCCCCTGGCTGGCTGCTTGG + Intronic
1062133959 9:134914954-134914976 TCACCCCCAGGCTAAATCCATGG - Intronic
1185824440 X:3236396-3236418 GTCTCCCCAGGCTGAAATCAAGG + Intergenic
1186513771 X:10150664-10150686 TCTGCACCAGGCAGAATGCAAGG - Intergenic
1187981806 X:24765202-24765224 TCCTTCCCAGGCTTGGTGCAGGG + Intronic
1189279939 X:39813971-39813993 TCCTCCCCATGCTGTTTGCCGGG + Intergenic
1189323829 X:40101320-40101342 TCCTCCCCTTGCTGAGTGCTGGG - Intronic
1190143037 X:47864949-47864971 TGCTCAGCAGGCAGAATGCAAGG - Intronic
1191016972 X:55819272-55819294 ATTTTCCCAGGCTGAATGCAGGG - Intergenic
1192479754 X:71474842-71474864 TCTTCCCCTTGCTCAATGCACGG - Intronic
1197712319 X:129680201-129680223 TTCTCCCCTGGTTTAATGCAAGG - Intergenic
1198223994 X:134628748-134628770 TCATCTCCAGGCAGAATTCAGGG - Intronic
1200211062 X:154346762-154346784 TCGTCCCCAGGCTGCAGGGAGGG - Intergenic
1200212954 X:154355036-154355058 TCCTCCCCAATCTGAATGGTGGG + Exonic
1200219790 X:154385330-154385352 TCGTCCCCAGGCTGCAGGGAGGG + Intergenic
1201851630 Y:18489412-18489434 TCCTCTCCAGGATGATTGGAAGG - Intergenic
1201881690 Y:18830968-18830990 TCCTCTCCAGGATGATTGGAAGG + Intergenic