ID: 923629428

View in Genome Browser
Species Human (GRCh38)
Location 1:235640169-235640191
Sequence CAGGCACATCATGCTTACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923629424_923629428 0 Left 923629424 1:235640146-235640168 CCTGGGGAGGAGACCTGGTGTTG 0: 1
1: 0
2: 1
3: 23
4: 205
Right 923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
923629422_923629428 12 Left 923629422 1:235640134-235640156 CCATGCATTCAGCCTGGGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 241
Right 923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923629428 Original CRISPR CAGGCACATCATGCTTACGG TGG Intronic
910320736 1:85940563-85940585 CAAGCACTTCATGATTATGGAGG + Intronic
915991633 1:160523181-160523203 CAGCCACAACATGCTTTCCGCGG + Exonic
923032806 1:230263357-230263379 CAGACACTGCATGCTTGCGGAGG - Intronic
923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG + Intronic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1071421788 10:85507758-85507780 AAGGCACATAATGCTTACTCTGG + Intergenic
1071455764 10:85850311-85850333 CAGGCAAGTCATGCTTGTGGAGG + Intronic
1078122178 11:8522168-8522190 CATGCACATGATGTTTACTGTGG + Intronic
1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG + Intergenic
1088389993 11:109303648-109303670 CAGGCATAGCATGCTTACACTGG - Intergenic
1089400265 11:118160385-118160407 GAGTCACATCATGCTGATGGGGG + Intergenic
1090256197 11:125286483-125286505 CAGGCACAATAGGCTTACGTAGG - Intronic
1103743334 12:123106025-123106047 CAGGCATACCATGCTTGCAGGGG - Intronic
1105004434 12:132712293-132712315 CAGCCAAAACATGCCTACGGAGG - Intronic
1105756591 13:23470581-23470603 CCAACACAGCATGCTTACGGAGG + Intergenic
1121875496 14:97447475-97447497 AAGCCACATCATGCTTACCCAGG - Intergenic
1124873049 15:33562706-33562728 CAGGCACATCATGATTATTTTGG + Intronic
1129955383 15:79631475-79631497 CATGCACATCATGCTTCTGTTGG - Intergenic
1141167086 16:81668224-81668246 CAGCCACATCACGTTTATGGAGG + Intronic
1150918763 17:69461689-69461711 CAGGCACCCCTTGCTCACGGAGG + Intronic
1152715721 17:81899635-81899657 CAGGCTCATCATGCTCAGTGGGG - Intronic
1158468692 18:57714416-57714438 CAGCCAGATCATGGTTACAGTGG + Intronic
925967854 2:9083029-9083051 AAGGTACATCATGTTTACTGGGG + Intergenic
926558718 2:14391640-14391662 CAGACACATCATTATTACAGTGG - Intergenic
927682993 2:25152331-25152353 CAGTCAGATCATGCTCACTGTGG + Intronic
936504271 2:113092622-113092644 CAAGCACAGCATGCTTCAGGAGG - Intergenic
1170445615 20:16424358-16424380 CAGGGACATTATGCTTTTGGAGG - Intronic
1170550742 20:17474074-17474096 CAGGCACACCATGGCTAAGGGGG + Intronic
1172701430 20:36855819-36855841 CAGGGACAGCATGCACACGGAGG + Intronic
1176896258 21:14382833-14382855 CAGGGACATCAGGCTTAGGGAGG - Intronic
1180632719 22:17240923-17240945 CAGGCACGTCTTGGTTACTGAGG - Intergenic
1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG + Exonic
950026999 3:9826988-9827010 CATGCACATGATGCCTACGGGGG - Exonic
952172666 3:30826040-30826062 CAGGCACAGCATGCTTATTATGG + Intronic
952541516 3:34372463-34372485 CAGGCACATCATTCTCAAGGTGG - Intergenic
954556561 3:51521839-51521861 CAGGAATAACATGCTTACAGTGG - Intergenic
960038584 3:113126604-113126626 CAGGCACTTCCTGCTTTTGGTGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
979071419 4:116212726-116212748 CAGCCTCTTCATGCTTAAGGTGG - Intergenic
992702708 5:79357081-79357103 CAGGCACATCAGGAGTACAGTGG + Intergenic
997440027 5:133902640-133902662 GAGGCACCACATGCTGACGGAGG + Intergenic
1000642432 5:163718533-163718555 CAGGCTCATCATGCTTCCCTAGG + Intergenic
1003080283 6:3016015-3016037 CAGGCACATGATGCTCAAGGGGG - Intronic
1019408061 7:894281-894303 CGGGCACACCAGGCTCACGGAGG - Intronic
1022686005 7:32597096-32597118 CAGGCACATGATGCTCGAGGGGG - Intergenic
1023102849 7:36736545-36736567 CAGGCACTTCATCATTAGGGTGG + Intergenic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1035595689 8:855595-855617 CAGGCACCTGAAGCTTACGTGGG - Intergenic
1041395872 8:57390740-57390762 AAGGTACATCATGTTTACTGTGG - Intergenic
1043913964 8:85898605-85898627 AAGGCACATCATGATTATGTTGG - Intergenic
1048633630 8:136271713-136271735 TAGGCAAATCCTGCTTAAGGTGG + Intergenic
1052437057 9:28443512-28443534 CAGGCACATCAAGCCTGAGGGGG - Intronic
1061600140 9:131663621-131663643 CAGGCAGATCCAACTTACGGGGG - Intronic
1062514523 9:136925937-136925959 CAGGCACAGCCGGCTCACGGAGG + Exonic
1062565101 9:137160833-137160855 CAGGCAGACGATGCTGACGGTGG + Intronic