ID: 923630945

View in Genome Browser
Species Human (GRCh38)
Location 1:235649428-235649450
Sequence ACCCGCGCGCGGGCTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923630939_923630945 6 Left 923630939 1:235649399-235649421 CCTGGACGCGCTCCGAGGGGGCT 0: 1
1: 0
2: 1
3: 6
4: 73
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630938_923630945 7 Left 923630938 1:235649398-235649420 CCCTGGACGCGCTCCGAGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 60
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630928_923630945 22 Left 923630928 1:235649383-235649405 CCCAGCCCCGGAAGCCCCTGGAC 0: 1
1: 0
2: 0
3: 26
4: 226
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630931_923630945 16 Left 923630931 1:235649389-235649411 CCCGGAAGCCCCTGGACGCGCTC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630927_923630945 23 Left 923630927 1:235649382-235649404 CCCCAGCCCCGGAAGCCCCTGGA 0: 1
1: 0
2: 3
3: 41
4: 456
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630940_923630945 -6 Left 923630940 1:235649411-235649433 CCGAGGGGGCTGTCCACACCCGC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630932_923630945 15 Left 923630932 1:235649390-235649412 CCGGAAGCCCCTGGACGCGCTCC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630925_923630945 24 Left 923630925 1:235649381-235649403 CCCCCAGCCCCGGAAGCCCCTGG 0: 1
1: 0
2: 7
3: 60
4: 647
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630929_923630945 21 Left 923630929 1:235649384-235649406 CCAGCCCCGGAAGCCCCTGGACG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630930_923630945 17 Left 923630930 1:235649388-235649410 CCCCGGAAGCCCCTGGACGCGCT No data
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89
923630936_923630945 8 Left 923630936 1:235649397-235649419 CCCCTGGACGCGCTCCGAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923630945 Original CRISPR ACCCGCGCGCGGGCTTCCCC GGG Intronic
901069266 1:6509170-6509192 GCCCTCACGCGGGCTGCCCCTGG + Intronic
901264889 1:7902905-7902927 ACCAGCGCGCAGGCCTCCCTCGG - Intergenic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
905862741 1:41361833-41361855 CCCCTCCCGCGGGCCTCCCCGGG + Intergenic
905886900 1:41496534-41496556 ACCCGCGCCTCGCCTTCCCCTGG + Intergenic
906403344 1:45521729-45521751 ACCCGAGCGCGGGCGGGCCCCGG + Exonic
907767317 1:57424026-57424048 GCGCTCGCCCGGGCTTCCCCGGG - Exonic
907905909 1:58783736-58783758 AGCCGCTCGCCGACTTCCCCCGG + Exonic
910773382 1:90851573-90851595 AACCACGCGCGGGCTCCCGCCGG + Intergenic
915568187 1:156728486-156728508 ACCCGCGCGCCTGCCTTCCCGGG - Exonic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
921389729 1:214606131-214606153 TCCCGCCAGCGGGCGTCCCCGGG + Intronic
922152200 1:223016232-223016254 ACCCACGGGCAGGCTTCCCAAGG + Intergenic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1071532405 10:86400398-86400420 ACCGGCGGGCGGTCTTCCCCGGG - Intergenic
1074065397 10:110008361-110008383 ACCCGCGCGGGGGCTAGCACTGG + Intronic
1074088385 10:110226001-110226023 AACCACGCGCGGGCTGCCCGCGG + Intronic
1077065645 11:639993-640015 ACCCGCGCCCCGCCTCCCCCAGG + Exonic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077065706 11:640137-640159 CCCCGCGCCCGGCCTCCCCCCGG + Exonic
1081873211 11:46392360-46392382 ACCCGCTCCTGCGCTTCCCCAGG - Intergenic
1082076865 11:47981254-47981276 GCCCGCGCGGAGGCTTTCCCCGG - Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1091259808 11:134225055-134225077 ACCGGGGCGCGGGCTGCCCTAGG - Exonic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1103509774 12:121466762-121466784 ACGCGCGTGCCGGCTGCCCCGGG - Intronic
1103701318 12:122850161-122850183 ACGTGGGCACGGGCTTCCCCAGG + Intronic
1106264784 13:28100382-28100404 ACCCGGGCGCGCGCCTCCTCCGG - Intronic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1113656921 13:112073116-112073138 AGCCGCGCGCGGGCCTCGGCGGG - Intergenic
1116849366 14:49893123-49893145 CCCCGAGCGCGGGCTCCCTCCGG - Exonic
1117912398 14:60648396-60648418 ACCCGCGCGTGGGTTTCTCTGGG - Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1123739943 15:23226442-23226464 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1124291167 15:28455410-28455432 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1126848833 15:52785510-52785532 GCCTGCGCGCCGCCTTCCCCTGG + Intronic
1129539333 15:76338112-76338134 ACCCGCCTGCGGGCATTCCCGGG - Intronic
1129752716 15:78077251-78077273 AGCCGCCCGCGCGCTTCCGCCGG - Intronic
1131144369 15:90001746-90001768 GCCTGCGCGCGGCCGTCCCCAGG - Intronic
1132683272 16:1152540-1152562 ACGCGCGCGCGGGCACACCCGGG + Intergenic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1134024718 16:10944903-10944925 ACCACCACACGGGCTTCCCCGGG - Intronic
1137555043 16:49465121-49465143 CCCCGCGCTCAGGCTGCCCCGGG - Intergenic
1137617020 16:49854727-49854749 GCCGGCGCGCGGCCTTTCCCCGG + Intronic
1139853787 16:69965468-69965490 ACCCGGGCGCGCGCTGCCCGAGG + Intergenic
1141908581 16:87043271-87043293 AACCTCGCCCGGGCTTCCCATGG + Intergenic
1143390375 17:6556287-6556309 ACCTGCGCGAGGGGTTCACCTGG + Intronic
1143749949 17:9021148-9021170 CCCCGCCCGCGCGCTCCCCCGGG + Intergenic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1151570513 17:74923318-74923340 AGCCGCCCCCGGTCTTCCCCTGG + Intergenic
1156260970 18:35444766-35444788 ACCCAGGGGCGGGCTTCCCATGG - Intronic
1160156928 18:76441605-76441627 GCCCGCTCGCGCGCTTCCGCGGG + Exonic
1160453261 18:78979507-78979529 TCCCCTCCGCGGGCTTCCCCCGG - Intergenic
1161412921 19:4126812-4126834 ACCCAGGAGCAGGCTTCCCCAGG - Intergenic
1161925111 19:7294058-7294080 AGCCGCGCGCGCCCTTCCCGGGG - Intergenic
1165311376 19:35030945-35030967 AGCCGCGCGAGGGCCACCCCCGG + Intronic
1167564846 19:50249744-50249766 ACCAGCGTGAGGGCATCCCCTGG + Exonic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
925609478 2:5691884-5691906 AGCCGCGCCCGGCCTGCCCCGGG - Intergenic
934522030 2:95025683-95025705 ACCCGCGCGCGGGGGCGCCCAGG + Exonic
936038376 2:109129932-109129954 ACGCGCGGGCGGGCTGCCGCCGG - Exonic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1184046794 22:41976982-41977004 AGCGGGGCGCGGGCTTCCCCGGG - Exonic
950525079 3:13518678-13518700 TCCCGCCTGCAGGCTTCCCCGGG - Intergenic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968187019 3:196639885-196639907 TCCCGCGTGGGGGCGTCCCCGGG + Intronic
968480198 4:829889-829911 TCCCAGGCGCTGGCTTCCCCCGG - Intergenic
969239253 4:5888402-5888424 AGCCGCGCGTGGGCATCCACGGG - Intronic
972740333 4:41881661-41881683 TCCCGCGCCCCGGCTCCCCCAGG + Intergenic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
982092288 4:151891072-151891094 TCCCACTCTCGGGCTTCCCCTGG + Intergenic
983229166 4:165112590-165112612 CCCCGCGCCCAGGCCTCCCCGGG + Intronic
995623765 5:114055507-114055529 GCCCGCCAGCCGGCTTCCCCCGG - Intergenic
998152334 5:139764593-139764615 AGCCGCGCGCCGCCCTCCCCCGG + Intergenic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1006136202 6:31897567-31897589 GCACGGGCGCGCGCTTCCCCCGG + Intronic
1008920907 6:56843604-56843626 ACCGGCGCGCTGCCTTCACCGGG + Intronic
1017021311 6:150142782-150142804 ACCCGCGCAGGAGCATCCCCTGG + Intergenic
1019528606 7:1492856-1492878 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528633 7:1492924-1492946 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528647 7:1492958-1492980 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1022428038 7:30285847-30285869 ACCCGCGCTCGGTCCTCCCGCGG + Intronic
1026000445 7:66556630-66556652 ACCTGGGCGGGGGCTTCTCCAGG - Intergenic
1028268649 7:88759561-88759583 ACCCGCGCCTGAGCATCCCCCGG + Exonic
1029746462 7:102517909-102517931 ATCCGCGACCGGGGTTCCCCAGG + Intergenic
1029764399 7:102616888-102616910 ATCCGCGACCGGGGTTCCCCAGG + Intronic
1035160905 7:156949557-156949579 ACCCGCGGGCGCGCCTGCCCCGG + Intergenic
1035282238 7:157785486-157785508 ACTCGCGGGCAGGCCTCCCCAGG + Intronic
1041244902 8:55880312-55880334 CCCCGCGCCCTGGCTCCCCCGGG - Intronic
1057306991 9:93918236-93918258 ACCCAGGCGCAGGCTTCCCAGGG - Intergenic
1060759315 9:126234717-126234739 ACCCTGGCTTGGGCTTCCCCTGG + Intergenic
1061860343 9:133464750-133464772 TCCCCAGCGTGGGCTTCCCCTGG + Intronic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1189056189 X:37701733-37701755 ACACGCAGGCAGGCTTCCCCAGG + Intronic