ID: 923631010

View in Genome Browser
Species Human (GRCh38)
Location 1:235649649-235649671
Sequence GGCGCCCACTTACCCGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923630999_923631010 3 Left 923630999 1:235649623-235649645 CCCGCGGACACCCGGGGCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 152
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
923631005_923631010 -8 Left 923631005 1:235649634-235649656 CCGGGGCTCCGGCCGGGCGCCCA 0: 1
1: 0
2: 0
3: 32
4: 314
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
923630994_923631010 18 Left 923630994 1:235649608-235649630 CCGGGCTGGGCTCTCCCCGCGGA 0: 1
1: 0
2: 0
3: 15
4: 208
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
923630998_923631010 4 Left 923630998 1:235649622-235649644 CCCCGCGGACACCCGGGGCTCCG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
923631001_923631010 2 Left 923631001 1:235649624-235649646 CCGCGGACACCCGGGGCTCCGGC 0: 1
1: 0
2: 2
3: 23
4: 191
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
923631004_923631010 -7 Left 923631004 1:235649633-235649655 CCCGGGGCTCCGGCCGGGCGCCC 0: 1
1: 0
2: 1
3: 51
4: 390
Right 923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923631010 Original CRISPR GGCGCCCACTTACCCGGAGC GGG Exonic
901203593 1:7481124-7481146 GGCTCCCTCCTACCCAGAGCTGG + Intronic
902940935 1:19799842-19799864 GGGGCCCCCTTACCTGGAGGCGG + Exonic
915944967 1:160142890-160142912 TGTGCCCACTTACCCTGGGCTGG + Exonic
923540735 1:234886278-234886300 GGTGCCCACCCACCCTGAGCTGG - Intergenic
923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG + Exonic
1066406907 10:35127076-35127098 GCCGCCCAGCAACCCGGAGCCGG - Intronic
1070678618 10:78433322-78433344 GGCCCCCACTGAGCTGGAGCTGG - Intergenic
1070915051 10:80148208-80148230 GGCGCCCACTGCCCTGGAGGGGG + Intergenic
1074555561 10:114485950-114485972 GGCTCCCACGTACCCAGAGCCGG - Intronic
1076809591 10:132879666-132879688 GGGGCCCACAGACCCGTAGCCGG - Intronic
1076898530 10:133325786-133325808 GGCGCGCACCTACCCCGGGCCGG + Exonic
1077086671 11:755943-755965 GATGCCCGCTTACCAGGAGCTGG + Exonic
1077098925 11:812624-812646 GGCCACCACTTACCTGCAGCAGG - Exonic
1077431705 11:2518904-2518926 GGCGTCCATTCACCCGGAGCTGG + Intronic
1077919035 11:6629750-6629772 GGCGCCTACTTTCCAGCAGCAGG - Exonic
1078771866 11:14358930-14358952 GCCGCACACGTCCCCGGAGCCGG - Exonic
1084310305 11:68312796-68312818 TGCGCCCACCTACCCGCGGCGGG - Exonic
1089433056 11:118437875-118437897 GGGGCCCCCTTCCCCAGAGCTGG - Intronic
1091638263 12:2214664-2214686 CGGGCCCACCTCCCCGGAGCAGG - Intronic
1100186428 12:92145175-92145197 GGCGCCCCCTTCCCCCCAGCTGG - Intronic
1104215018 12:126726533-126726555 GGGCCGCACTTACCCGGAGCTGG - Intergenic
1108484360 13:50909743-50909765 GGCGCCGAGTGACGCGGAGCGGG - Exonic
1114847247 14:26337902-26337924 GGCACCCACTTACCGAAAGCAGG - Intergenic
1120864326 14:89283083-89283105 GGAGCTGACTTACCCTGAGCTGG - Intronic
1125930021 15:43593814-43593836 GGCGGCCACATCCCCGGGGCGGG + Intronic
1125943189 15:43693646-43693668 GGCGGCCACATCCCCGGGGCGGG + Exonic
1137334782 16:47537428-47537450 GGGGCCCAGTTTCCCTGAGCTGG - Intronic
1142482127 17:225587-225609 GGCTCACACTTCCCGGGAGCAGG + Intronic
1143483357 17:7239304-7239326 GGCGCCCCCCTCCCCGGAGCCGG + Exonic
1145865124 17:28236236-28236258 GGCCACCACTTAGCCAGAGCTGG + Intergenic
1152103229 17:78314812-78314834 GGCGCCCCCCTCCCCAGAGCTGG + Intergenic
1152640022 17:81445453-81445475 GGCGCCCCCTCACCCGCTGCAGG + Exonic
1160244522 18:77146421-77146443 GGAGCCCACTTCCCCTGAGCCGG + Intergenic
1161801972 19:6421378-6421400 AGCTCCCACTGACCCGGGGCAGG - Intronic
1162145372 19:8609733-8609755 GCCGCCCACTTCCCCTGAGTTGG - Intronic
1162731773 19:12722464-12722486 GAGGCCCACTTACCCGGCCCCGG + Intronic
1166120644 19:40684404-40684426 CGCGCCCACTCACCCTGACCGGG + Exonic
1166333551 19:42092056-42092078 TGCACCCACTTACCCCGTGCTGG + Exonic
1167293254 19:48635825-48635847 GGCGCCAACAGACCCGGGGCGGG + Exonic
937087681 2:119182153-119182175 AGGGCCCACTTCCCTGGAGCAGG - Intergenic
948420785 2:237859118-237859140 GGCGCACACTTACCAGGCCCTGG - Intronic
1170629880 20:18057329-18057351 GGCGCCCCCTTCCCCGTAGTGGG - Intronic
1174290355 20:49504094-49504116 GGCCCCCACTCACAGGGAGCTGG - Exonic
1174436476 20:50510575-50510597 GGCGGCCATTTACCAGGTGCGGG + Exonic
1175678430 20:60966914-60966936 GGCTCCCTCTTACCTGGAGGAGG + Intergenic
1176215934 20:63947758-63947780 GGCTCCCCCTTACCCTGGGCAGG - Intronic
1184342122 22:43891815-43891837 GGCGCCCAGGTAGCCGGCGCCGG + Exonic
1185003387 22:48260547-48260569 GGCCACCACTTCCCTGGAGCTGG - Intergenic
1185384481 22:50525548-50525570 GGCGCCCGCTTTCCCTGAGCCGG - Intronic
961271980 3:125696330-125696352 GGCCACCACTTAGCCAGAGCTGG - Intergenic
966872485 3:184299776-184299798 TCCTCCCACTTACCCGGGGCAGG - Intronic
968046207 3:195625028-195625050 GGCGCCCTAGTACCCAGAGCCGG + Intergenic
968308446 3:197665059-197665081 GGCGCCCTAGTACCCAGAGCCGG - Intergenic
975650882 4:76591685-76591707 GGCGCCAACCTACCCGGAAAGGG + Intronic
985747103 5:1653847-1653869 GGCGCCCTAGTACCCAGAGCTGG - Intergenic
992269758 5:75052935-75052957 GGCGCGCCCTTGCCGGGAGCAGG - Intergenic
992549391 5:77846763-77846785 GGCGCCCGCTTGCCCAGAGGGGG + Intronic
997329822 5:133052048-133052070 TGCGGCCACTGAGCCGGAGCCGG + Exonic
997907435 5:137832700-137832722 GAGGCCCAGTTAACCGGAGCTGG + Intergenic
998336212 5:141374644-141374666 TGGGCCCAAGTACCCGGAGCTGG + Exonic
999092448 5:148948518-148948540 GGCCCCCACTCACAGGGAGCTGG + Intronic
999730924 5:154476333-154476355 GGGGCCCCCTAAGCCGGAGCTGG + Intronic
1000246894 5:159455901-159455923 GGTGCCCACATAGCCAGAGCTGG + Intergenic
1003124896 6:3348325-3348347 GGCGCCATCTTTCCTGGAGCAGG + Intronic
1007473259 6:42104306-42104328 GAGGCCCACTTACCGGGAGAGGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1024210884 7:47202555-47202577 GGCTGCCACATACCTGGAGCTGG + Intergenic
1036820193 8:11933914-11933936 GGCCACCACTTAGCCAGAGCTGG + Intergenic
1039989011 8:42472199-42472221 GGCGCCTAGTAACACGGAGCCGG + Exonic
1057512267 9:95690458-95690480 GGCTCGCACTTGCCCTGAGCTGG + Intergenic
1062425172 9:136502947-136502969 GGCACCCACTTTCCCGTGGCTGG + Intronic
1194400276 X:93432726-93432748 GGCCACCACTTAGCCAGAGCTGG - Intergenic
1200911898 Y:8538457-8538479 GGCCACCACTTAGCCAGAGCTGG - Intergenic
1200983838 Y:9286180-9286202 GGCTACCACTTAGCCAGAGCTGG + Intergenic
1202126527 Y:21573510-21573532 GGCTACCACTTAGCCAGAGCTGG - Intergenic