ID: 923631278

View in Genome Browser
Species Human (GRCh38)
Location 1:235650351-235650373
Sequence GCGGGGCCGGGGTTGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923631272_923631278 -8 Left 923631272 1:235650336-235650358 CCGGAGGGGTCTGGGGCGGGGCC 0: 1
1: 1
2: 5
3: 53
4: 405
Right 923631278 1:235650351-235650373 GCGGGGCCGGGGTTGCTGGAGGG 0: 1
1: 1
2: 0
3: 24
4: 372
923631263_923631278 7 Left 923631263 1:235650321-235650343 CCGGGGGGGAAATCACCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 923631278 1:235650351-235650373 GCGGGGCCGGGGTTGCTGGAGGG 0: 1
1: 1
2: 0
3: 24
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923631278 Original CRISPR GCGGGGCCGGGGTTGCTGGA GGG Intronic
900114186 1:1021480-1021502 GGGGGGCTGGGGCTGCCGGATGG - Intronic
900143800 1:1149557-1149579 GCTGGGGTGGGTTTGCTGGAGGG + Intergenic
900205011 1:1427932-1427954 GCGGGGGCGGGGCTGCGGGCGGG - Intergenic
900319201 1:2074229-2074251 GCGAGGCAGGGGCTGCTGGAGGG + Intronic
900624963 1:3603816-3603838 CTGGGGCCAGGGTGGCTGGACGG - Intronic
900713107 1:4127521-4127543 GGGCGGCCGGGGCTCCTGGAGGG + Intergenic
901817990 1:11805855-11805877 GCGAGGCCGGGGTCGCCGGGAGG - Intronic
901860283 1:12069987-12070009 AGGAGGCCGGGGTGGCTGGAGGG + Intronic
902243425 1:15103360-15103382 GCGGGCCCGGCGCTCCTGGAGGG - Exonic
902369263 1:15995145-15995167 GTGGGGCCGGGGGCGCTGGAGGG - Intergenic
902807100 1:18868002-18868024 TCGGGGCAGGCGTCGCTGGAGGG - Intronic
903177625 1:21590237-21590259 GCGGAGCCCGGGTGGCTGGCGGG + Intergenic
903651190 1:24923339-24923361 GCAGGGCCGGGGTAGCTGAGGGG - Intronic
904007224 1:27369713-27369735 GGGGGGCCGGGGATTCTGGAGGG - Intronic
904307951 1:29602354-29602376 GAGGGGCAGAGGTTGCTGCAGGG - Intergenic
904463487 1:30694216-30694238 GCGGGGCGGGGGTGGGTGGGGGG - Intergenic
904528801 1:31155008-31155030 GCGGGGCCGGAGTCGAGGGAGGG + Intergenic
904620606 1:31772901-31772923 GCGGGCCCGGGGTCCCTGGGAGG - Intergenic
905237007 1:36557191-36557213 GCTGGGCAGGGGTTGCTGAGTGG + Intergenic
905648169 1:39639315-39639337 GCAGGGCTGGGGATGCTGGCAGG - Intronic
906180312 1:43812271-43812293 GCGGGGCCTGCGTTGCTGCCTGG + Intronic
910288394 1:85578066-85578088 GGGAGGCTGGGGTTTCTGGACGG + Intronic
911002619 1:93181193-93181215 GCGGGGGCGGGGGTGGGGGACGG - Intronic
913110479 1:115653262-115653284 TCGGGGCAGGTGCTGCTGGACGG + Intronic
913110679 1:115654667-115654689 TCGGGGCAGGTGCTGCTGGACGG - Intronic
915722465 1:157994555-157994577 GCAGGGCTGGGGTTGGGGGAGGG + Intronic
915934740 1:160083918-160083940 GCGGCGTCGGGGGTCCTGGAGGG - Exonic
917959630 1:180132034-180132056 GAGGGGCCGGTGTTGATGGGAGG + Intergenic
919299462 1:195742022-195742044 GCGGGGCGGGGGTGGGGGGAGGG + Intergenic
919910088 1:202105918-202105940 GCTGGGCCAGCTTTGCTGGAAGG - Intergenic
919910261 1:202106751-202106773 GCGGGGCCTGGGCTGCTCTAGGG - Intergenic
919926676 1:202195071-202195093 GCGGGGCTGGGGGTGCAGGTGGG - Intronic
920200656 1:204257915-204257937 GTGGGGCTGGGGTGGGTGGAGGG - Intronic
920286259 1:204882016-204882038 GCAGGGTGGGGGTTGGTGGATGG - Intronic
920312063 1:205054403-205054425 GCGAGGCCTGGGGGGCTGGATGG - Intronic
920416166 1:205800532-205800554 GGGGGGCTGGGGGTGCTGGGAGG + Intronic
920805707 1:209231812-209231834 GCGGGGCCGGGGTCGCGGGCTGG + Intergenic
923547271 1:234932007-234932029 GAGGGGGCGGGGCAGCTGGAGGG - Intergenic
923631278 1:235650351-235650373 GCGGGGCCGGGGTTGCTGGAGGG + Intronic
924225405 1:241917726-241917748 GCGGGGCCCTGGTTCCAGGAGGG + Intergenic
1066293611 10:34035492-34035514 CCGGGGCCGGTGGTGCTGGCTGG - Intergenic
1067841006 10:49679580-49679602 GCGGGGCCGGGGTGGCGCTAGGG - Intergenic
1072881819 10:99235747-99235769 GGGGGGCGGGAGTTGCTGGAGGG + Exonic
1073064944 10:100752750-100752772 GAGGGGCAGGGGGTGTTGGACGG - Intronic
1074532076 10:114305027-114305049 GAGGGGGCGGGGCTGCGGGAGGG + Intronic
1074532128 10:114305195-114305217 GAGGGGGCGGGGCTGCGGGAGGG + Intronic
1074532253 10:114305675-114305697 GAGGGGACGGGGCTGCAGGAGGG + Intronic
1074532347 10:114305977-114305999 GAGGGGTCGGGGCTGCAGGAGGG + Intronic
1074532381 10:114306139-114306161 GAGGGGACGGGGCTGCAGGACGG + Intronic
1076486727 10:130824977-130824999 GAGGGGCAGGGGGTGCTGTAGGG - Intergenic
1076599043 10:131645414-131645436 GGTGGGCCGGGGTCCCTGGAGGG + Intergenic
1076683480 10:132186800-132186822 GCGGGGGCGGGGCTGATGGGCGG + Intergenic
1076697352 10:132253376-132253398 GGGGAGCCGAGGTAGCTGGAGGG + Intronic
1076707095 10:132307995-132308017 GCAGGGGCGGGGCTTCTGGAAGG + Intronic
1076783785 10:132739078-132739100 GTGGGGCAGGGTTTGCTGGGAGG - Intronic
1077360840 11:2139539-2139561 GCGGGGCGGGGGGTGCGGGCTGG + Intronic
1078377394 11:10808015-10808037 GCGAGGCCCGGGTCGCTCGACGG + Intronic
1079187305 11:18248937-18248959 GCGGCACCTGGGCTGCTGGAAGG + Intergenic
1079189495 11:18265946-18265968 GCGGCACCTGGGCTGCTGGAAGG - Intergenic
1083225334 11:61281183-61281205 GTGTTGCCGGGGTTGCAGGATGG + Exonic
1083593686 11:63909260-63909282 GCGGGGGCGGGCCAGCTGGACGG + Exonic
1083667679 11:64284673-64284695 CCGGAGCCCGGGGTGCTGGAGGG - Exonic
1083684724 11:64369372-64369394 GCGGGGCCTGGGTGGTGGGAGGG + Intronic
1083900759 11:65642192-65642214 GCGGGGGCGGGGCTGCCAGAGGG + Intronic
1083904863 11:65662849-65662871 GCGGGGCCGGGGTCGCAGCTGGG + Exonic
1084215540 11:67645238-67645260 GCGGGGCCAGGAGGGCTGGAGGG - Intronic
1084417815 11:69043572-69043594 GCTGGGCAGGGCTTGCTGGGGGG + Intergenic
1084444535 11:69196081-69196103 CCGGGGCCGGGGTTGGGGGCTGG - Intergenic
1088462276 11:110093662-110093684 GCGGGGACGGCGTTGCCCGAGGG - Intronic
1089533944 11:119149466-119149488 GCGGGCCCGGGGGTGCCGGCGGG + Intronic
1090224825 11:125063532-125063554 GCGTGGCCAGGGGTGCTGGGGGG + Intronic
1090403773 11:126465409-126465431 GCAGCCCCGGGGGTGCTGGACGG + Intronic
1093738963 12:22658669-22658691 GCAGGGTCGGGGTTGGCGGATGG + Intronic
1096718135 12:53503160-53503182 GCAGGGCCTGGGTTCCTTGAAGG - Intronic
1097281237 12:57846447-57846469 GCGGGCCCGGGCTGGCTGGGCGG + Exonic
1101253474 12:102956608-102956630 GCGGGGCGGGGGTTGAGTGATGG - Intronic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1103988936 12:124785368-124785390 GTAGGGCCAGGGTGGCTGGAGGG - Intronic
1104829490 12:131740127-131740149 GGTGGCCCGGGGTAGCTGGATGG + Intronic
1104925462 12:132311758-132311780 GCAGGGCCTGGATTGCCGGAAGG - Intronic
1111902248 13:94213644-94213666 GCCGGGGCTGGGATGCTGGAGGG - Intronic
1113653882 13:112056340-112056362 GCGGGGGCGGGGGCGCGGGAGGG + Intergenic
1113904942 13:113814852-113814874 GTGGGGCAGGGGGTGCTGGGGGG + Exonic
1113904962 13:113814893-113814915 CCGGGGCAGGGGGTGCTGGGGGG + Exonic
1114051152 14:18920581-18920603 GCGGTGGCGGGGGTGGTGGAGGG + Intergenic
1114111410 14:19481344-19481366 GCGGTGGCGGGGGTGGTGGAGGG - Intergenic
1114455868 14:22853193-22853215 GCGGGGCAGGGTTTGCAGGGTGG + Intergenic
1115652758 14:35414881-35414903 GTGGGGCAGGGGCTGCTGGGTGG + Intergenic
1116833239 14:49742965-49742987 GCGGGGCTGAGGTTGGAGGATGG + Intronic
1118911349 14:70064552-70064574 GCGGCGGCGGGGATGCTGGGGGG + Intronic
1119821016 14:77616407-77616429 GCGGGGCCGGGGTGGCGGTGTGG - Intronic
1120976576 14:90254207-90254229 GCGGGGCCGGGGTGGACAGAGGG - Intergenic
1122349147 14:101077663-101077685 GCAGCGCCGGGATGGCTGGAGGG + Intergenic
1122374062 14:101247081-101247103 GAGGGGCAGGGGCGGCTGGATGG - Intergenic
1122617477 14:103029960-103029982 GGAGGGCTGGAGTTGCTGGATGG - Intronic
1122750445 14:103928736-103928758 GCGGGGCGGAGGCGGCTGGAGGG + Intronic
1122813967 14:104303290-104303312 GCTGGGCCGGGCTTGCTGTCTGG - Intergenic
1122910763 14:104826681-104826703 GAGGGGGCGGGGCTGCCGGAGGG + Intergenic
1122910772 14:104826699-104826721 GAGGGGGCGGGGCTGCCGGAGGG + Intergenic
1122921525 14:104882366-104882388 GCCGGGGCAGGGTTGCAGGACGG + Intronic
1122995224 14:105260029-105260051 GCGGGGCTGGGACTGTTGGAAGG + Intronic
1123412920 15:20074082-20074104 GCTGGGCCGGGGTGGCGGGAGGG + Intergenic
1123474744 15:20581809-20581831 GCGAGGCTGGGGGTGCTGGCGGG + Intergenic
1123522262 15:21081195-21081217 GCTGGGCCGGGGTGGCGGGAGGG + Intergenic
1123643267 15:22418548-22418570 GCGAGGCTGGGGGTGCTGGCGGG - Intergenic
1124368838 15:29091859-29091881 GCTGGGCCCGTGATGCTGGAGGG + Intronic
1125510660 15:40290894-40290916 GGGGGGCGGGGGTCGGTGGAGGG + Intronic
1125690823 15:41594830-41594852 GGGAGGCCGGGGCTGGTGGATGG - Intergenic
1128082180 15:64863283-64863305 GCAGGGCTGGGTTTGCCGGAGGG + Intronic
1132519714 16:381647-381669 GTGGGGCCGGGGCTGCGGGCGGG - Intronic
1132553420 16:562701-562723 CAGGGGCCAGGGTTGCTGGAGGG + Intronic
1132685058 16:1158789-1158811 GCGGGGCCGGGGGTGCGGCGGGG - Intronic
1132929340 16:2451005-2451027 GAGGGGCCGGGGCAGGTGGAGGG - Intronic
1133020482 16:2964753-2964775 GCGGGTGCGGGGTCGCTGGCTGG + Intronic
1133285472 16:4688681-4688703 GCGGGAGTGGGGGTGCTGGATGG + Intronic
1133627218 16:7582017-7582039 GGGGGGGGGGGGGTGCTGGATGG - Intronic
1134537813 16:15040742-15040764 GCCGGGCCTGGGGTGCTGGGGGG + Intronic
1135534146 16:23279801-23279823 GCAGGGCCGGGCTTGCTGGGAGG + Intronic
1136117556 16:28104518-28104540 GTGGGGGCGGGGTTGCTGCCAGG - Intronic
1136144317 16:28307028-28307050 CTGGGGCTGGGGCTGCTGGAGGG - Intronic
1136181313 16:28554273-28554295 GCGGGGCCGGGGCTCGGGGAGGG + Intronic
1136762044 16:32741494-32741516 GCGGGGGGGGGGTTGCTGCGCGG + Intergenic
1137402806 16:48167120-48167142 GGGGGGTGGGGATTGCTGGATGG - Exonic
1138089837 16:54165117-54165139 GAGGGGCCGTGGTTTCTAGAAGG - Intergenic
1139489616 16:67279356-67279378 GGCGGGCGGGGGTTGCTGCAGGG + Exonic
1139649774 16:68356444-68356466 GCAGGGCCGGTGTGGCTGCAGGG - Intronic
1139953893 16:70684511-70684533 GAGGGGTGGGGGTTGCTGGCAGG - Intronic
1140476765 16:75242850-75242872 GCTGGGCCGGGGTGGCGGGAGGG + Exonic
1141287966 16:82690211-82690233 GCTGGGGTGGGGTTGGTGGAGGG + Intronic
1141642591 16:85349873-85349895 GTGCGGCCTGGGTTGCTGTACGG + Intergenic
1141689613 16:85588778-85588800 GGGGGCCCGGGGACGCTGGAGGG + Intergenic
1141828890 16:86498618-86498640 GCGGGGCCTGGGTTTCCAGAAGG + Intergenic
1142234101 16:88913307-88913329 GCGTGGCTGGGTTTGCTGGCTGG - Intronic
1142509360 17:384819-384841 GCGGGGAGGGGGCGGCTGGAGGG + Intronic
1142590805 17:1005003-1005025 GAGGGGCCAGGCTTCCTGGAGGG - Exonic
1142613902 17:1124166-1124188 GGGTGGCCGGGGGGGCTGGAAGG + Intronic
1142668937 17:1478545-1478567 GCGAGGCGGGGGGTGCTGCAGGG - Intronic
1142743024 17:1941688-1941710 GAGGGGCAGGGGTGCCTGGAAGG - Intronic
1142762571 17:2050671-2050693 GCGGGGCGGGGGTCCCAGGAGGG + Intergenic
1142805794 17:2370504-2370526 GCGGGGCCGGGAGTGGTGGCTGG - Intronic
1142860075 17:2755878-2755900 GCGGGGCCCGGGTGGGCGGAGGG + Intergenic
1143188344 17:5023872-5023894 GGCGGGCAGGGGTGGCTGGATGG - Exonic
1143372714 17:6450269-6450291 GCGGGGTGGGGGGTGCTGGAAGG - Intronic
1143617837 17:8064220-8064242 GCAGGGCCGGGGCTGCAGGAGGG + Intergenic
1144344692 17:14339184-14339206 GCGGGGCCAGGGTTGCTGGAGGG + Intronic
1145014404 17:19387230-19387252 GCGGGGCTGGGGCGGCTGGCGGG - Intronic
1145970958 17:28956222-28956244 GCGGGGGCGGGGCAGCTGCAGGG + Exonic
1146058932 17:29594381-29594403 GAGGGGCCCTGGCTGCTGGAAGG + Intronic
1146371000 17:32265763-32265785 GCGGGGGCGGGGCTGCTCGCGGG - Intergenic
1146854824 17:36253747-36253769 GTGGGGCTGGGGGTGCTGGGAGG + Intronic
1146865796 17:36334629-36334651 GTGGGGCTGGGGGTGCTGGGAGG - Exonic
1146870724 17:36377639-36377661 GTGGGGCTGGGGGTGCTGGGAGG + Exonic
1146878082 17:36428720-36428742 GTGGGGCTGGGGGTGCTGGGAGG + Exonic
1146882023 17:36449824-36449846 GTGGGGCTGGGGGTGCTGGGAGG + Intergenic
1147068666 17:37935241-37935263 GTGGGGCTGGGGGTGCTGGGAGG - Exonic
1147073607 17:37978263-37978285 GTGGGGCTGGGGGTGCTGGGAGG + Intergenic
1147080189 17:38014778-38014800 GTGGGGCTGGGGGTGCTGGGAGG - Intronic
1147085129 17:38057801-38057823 GTGGGGCTGGGGGTGCTGGGAGG + Exonic
1147096137 17:38138738-38138760 GTGGGGCTGGGGGTGCTGGGAGG - Intergenic
1147101075 17:38181767-38181789 GTGGGGCTGGGGGTGCTGGGAGG + Intergenic
1147584904 17:41648475-41648497 TCGGGGCCGGGCAAGCTGGAGGG - Intergenic
1147689016 17:42304224-42304246 ACGGGGCAGGGGCTGCTGGCAGG + Intronic
1147789408 17:43004057-43004079 GAGGGGGCGGGGTGGCGGGAAGG + Intergenic
1147998574 17:44374955-44374977 GCGGGGCCGGGCCTTCTGGGCGG - Intronic
1148495123 17:48048737-48048759 GCGGGGTGGGGTTTGCTGTAAGG + Intronic
1148617700 17:49013489-49013511 GTGGGGCCGCGGAGGCTGGAGGG - Intronic
1149756979 17:59195021-59195043 TTGGGGTCGGGGGTGCTGGAGGG + Intronic
1150130466 17:62666292-62666314 GCGGGGGCAGTGTTCCTGGAGGG + Intronic
1151340568 17:73468130-73468152 GCAGGGCCGGGCTGGCAGGATGG + Intronic
1151575836 17:74952212-74952234 GCGGGGCCGGGGTTGTGGGCGGG - Intronic
1152269358 17:79314857-79314879 ACGGGGCTGGGTGTGCTGGAGGG + Intronic
1152533102 17:80931969-80931991 GCAGGGCCTGGGTTTCGGGAGGG - Intronic
1155007374 18:21741125-21741147 GAGGGGCCGGGGTGGCAGAAAGG + Intronic
1157359692 18:46965566-46965588 GGGGGGGCGGGGATGCTAGAGGG - Intronic
1157359841 18:46966633-46966655 GAGGGGCTGGGGTTTCTGGCTGG + Intronic
1157360440 18:47020233-47020255 GAGGGGCTGGGGTTTCTGGCTGG + Intronic
1157361429 18:47026148-47026170 GAGGGGCTGGGGTTTCTGGCTGG + Intronic
1157867048 18:51196755-51196777 GCGGCGGCGGGGGTGCTGTACGG - Exonic
1160316519 18:77853128-77853150 GCTGGGCCGGGGCTGTTGGGCGG - Intergenic
1160739847 19:680676-680698 GAGGGGCGGGGCCTGCTGGAGGG + Intronic
1160775429 19:853103-853125 CCGGGGCCGGGGCTGCTGGCGGG + Intronic
1160822802 19:1066276-1066298 GCGGGGTGGGGGTTGGGGGAAGG + Intronic
1160839665 19:1140489-1140511 TCCGGGCCAGGGTGGCTGGAGGG + Intronic
1160900925 19:1428075-1428097 GCGGGGCCGGGGACAATGGATGG - Intronic
1161048894 19:2151621-2151643 GCGGGGCGGGGCTTTCTGGGAGG - Intronic
1161104480 19:2436680-2436702 GCGCGGCCGTGGTGGCGGGAGGG - Intronic
1161311285 19:3595584-3595606 CAGGGGCTGGGGGTGCTGGATGG - Intronic
1161998616 19:7729894-7729916 GCGTGGCCGTGGTTACTGGCTGG - Exonic
1162019760 19:7863075-7863097 GCGGGGCCGGGGTCGGGGGGCGG + Intronic
1162312086 19:9913745-9913767 GCGGGGCAGGGGGTCCGGGACGG + Intronic
1162392239 19:10396502-10396524 GAGGGGCTGGTGTAGCTGGAAGG - Intronic
1162940458 19:14006071-14006093 GCGGCCCCGGGGTGGCTGGCCGG - Intronic
1162954487 19:14090727-14090749 GCGGGGCCGGGGATGCGAGGGGG + Intronic
1162964972 19:14151308-14151330 GCGGGCCCGGGGGTGCTGACCGG - Exonic
1163622429 19:18369003-18369025 GAGGGCCCGGGGCTGCTGGTTGG + Exonic
1163715552 19:18870374-18870396 GCGGGGCCGGTGTCCCCGGAGGG + Exonic
1165402820 19:35612815-35612837 GCGGGAACTGGGTTGCTGGGCGG + Exonic
1166043817 19:40218023-40218045 GCCGGCCCGGGGCTGCTGGTGGG + Exonic
1166310542 19:41959913-41959935 AGGGGGCCATGGTTGCTGGAGGG + Intergenic
1166341282 19:42138735-42138757 GCTGGGCTGGGGTGGCTGGGTGG + Intronic
1166796415 19:45428830-45428852 GCGGGGCCGGGGACGCAGGGGGG + Intronic
1167019186 19:46861348-46861370 GCGGGGCCCGGGGGGCTGGGGGG - Intergenic
1167111892 19:47467430-47467452 GCTGGGGAGGGGTTGCTGGAGGG + Intronic
1167472298 19:49682087-49682109 GCGGGGCCGGGCCTGAGGGATGG + Intronic
1167648916 19:50719347-50719369 GCGGGGCCGGGGCCGCGGGAGGG - Intronic
1167709985 19:51104557-51104579 GCGGGGCGGGCATTGCGGGAGGG + Exonic
1168528212 19:57105643-57105665 GGGGGGCGGGGGATGCTGGGGGG + Intergenic
925023229 2:588028-588050 GCAGGGCCAGGTTTCCTGGAAGG + Intergenic
925357563 2:3252810-3252832 GCAGTGCCGGGGTTCCTGTAAGG - Intronic
925773614 2:7309256-7309278 GCGGGGGCGGGGTAGGTGGGGGG + Intergenic
927496665 2:23555769-23555791 GCAGGGCCGGGGATGCTGTTGGG + Intronic
927698483 2:25252614-25252636 GCGGGGCCGGGGGGCCGGGAGGG + Intronic
928508085 2:31974671-31974693 GGGGGGCCAGGGTTGCGGGGAGG + Intronic
931804076 2:65787967-65787989 GCAGGGTGGGGGTTGGTGGATGG - Intergenic
932715891 2:74100656-74100678 GGGAAGACGGGGTTGCTGGATGG - Exonic
933512726 2:83261760-83261782 GCGGGGCAGGGGGTGGTGGTGGG + Intergenic
936401963 2:112171392-112171414 GCAGGGCCAGTGGTGCTGGATGG + Intronic
936921863 2:117697089-117697111 GCTGAGCAGTGGTTGCTGGAAGG + Intergenic
937692147 2:124768721-124768743 GCAGAGTCGGGGTTGCTGCAAGG - Intronic
939373864 2:141338442-141338464 TCAGGTCAGGGGTTGCTGGAAGG + Intronic
939739050 2:145883846-145883868 GAGGGGGTGGGGTGGCTGGAGGG - Intergenic
941987478 2:171522960-171522982 GCGGGGCCGGGGGTGCGCGGTGG + Intronic
942303584 2:174585537-174585559 GGGGCGGCGGGGGTGCTGGAGGG + Exonic
942434195 2:175953559-175953581 GCGGGGCAGGGGTTGGGGGTGGG - Intronic
944414481 2:199468763-199468785 GAGGGGCGGGGGCTGCTGGCGGG - Intronic
946219885 2:218217316-218217338 GAGGGGCCGGGGTGGAGGGAAGG - Exonic
946326065 2:218985238-218985260 GCGTGGCGGGGGTTGCGGGGGGG + Exonic
946692423 2:222319513-222319535 GCGGGGCCGGGGTGGGCGGCGGG + Intergenic
947122943 2:226836175-226836197 GCCGGGCTGGGGCTGCTGGGCGG + Intronic
947538538 2:230957548-230957570 GCGGCGCCGGCGGTGCTGGGCGG + Intronic
947834561 2:233166211-233166233 GCGGGGCAGGGGCTGGTGGGAGG - Intronic
948388997 2:237598644-237598666 GCGTCGCCAGGGATGCTGGAGGG - Intronic
948794910 2:240397547-240397569 GCAGTGCAGGGGGTGCTGGAGGG - Intergenic
949027782 2:241774453-241774475 CCGGGTCCGGGGCTGCAGGAAGG - Intergenic
1171010308 20:21505912-21505934 CCGGGGCGGGGGTTCCGGGAAGG - Intergenic
1172517047 20:35542196-35542218 GCGGGGCCGGGGTCGCGTGGAGG + Intronic
1172594569 20:36141543-36141565 GGGGGGCTGTGGTTGCTGAAAGG + Intronic
1172781346 20:37438536-37438558 GCGGGGCCGGTGGGGCGGGAAGG + Intergenic
1173453990 20:43189449-43189471 GAGGGGCCGGGCTCGCTGGCCGG + Intronic
1173794339 20:45848536-45848558 GCTGGGCTGGGCCTGCTGGAAGG + Exonic
1173859879 20:46276363-46276385 GAGGGGCCGGAGTTGCTTCAGGG + Intronic
1174075994 20:47937427-47937449 AAGGGGCCGGGGTTGTTGGCTGG - Intergenic
1174420675 20:50397179-50397201 GCAGGGCTGGGGTTTCAGGAGGG - Intergenic
1175496686 20:59419361-59419383 GCAGGGCCTGGGGTTCTGGAAGG + Intergenic
1175889878 20:62311355-62311377 GCAGAGCTGGGGTGGCTGGAAGG - Intronic
1176024527 20:62978900-62978922 GGGGGGCCGAGCTTGGTGGATGG + Intergenic
1176039100 20:63055072-63055094 GAGGGGCCGGGGCAGCCGGAGGG + Intergenic
1177894905 21:26846102-26846124 GCGGGGTGGGGGTTGGTGGAGGG - Intergenic
1177900191 21:26905123-26905145 GGGAGGCCGAGGTTGATGGATGG + Intergenic
1179994924 21:44969644-44969666 GCGGGGACGGGGGAGCTGCATGG - Intronic
1180136438 21:45865388-45865410 GCGCGGCCGGTGCTACTGGATGG + Intronic
1180469627 22:15642956-15642978 GCGGTGGCGGGGGTGGTGGAGGG + Intergenic
1180748942 22:18111213-18111235 GCGAGTCCGGGGATTCTGGATGG + Intronic
1180854334 22:19036760-19036782 GGCTGGCCGGGGTTGCTGGGTGG - Exonic
1181094697 22:20496992-20497014 GTGGGGCCGGGCTTGGTGGCTGG + Intronic
1181282833 22:21731973-21731995 CCGGGGCCGGGATTCCTGGTGGG - Intronic
1181497869 22:23298152-23298174 GCAGGGTAGGGGTTGATGGATGG + Intronic
1182387450 22:29957104-29957126 GGGGGGCGGGGGTGGCAGGAGGG - Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1184152883 22:42648982-42649004 GTGGGGCCTTGGCTGCTGGAGGG - Intronic
1184298992 22:43543848-43543870 GCGGGACTGGGGCTGCCGGAGGG - Intronic
1184404452 22:44292186-44292208 GCGGGGCGGGGGTCGGGGGAAGG + Intronic
1184457317 22:44618540-44618562 GCTGGCCTGGGGCTGCTGGACGG + Intergenic
1184523029 22:45007207-45007229 GGGGGGCCGGGCTTGCTGAAAGG - Intronic
1184766918 22:46577000-46577022 GCGGGGCCGGGGTGGCGCGCGGG + Intronic
1184856748 22:47150508-47150530 GGGTGGCCGGGCTTGCTGGGTGG + Intronic
1185163745 22:49245038-49245060 GCAGGGTTGGGGTTGATGGAGGG + Intergenic
949540206 3:5026670-5026692 GCCGGGCGGGGGTGGCCGGAAGG - Intergenic
950550131 3:13661308-13661330 CCGGGGCCGGGGTGGTGGGAGGG + Intergenic
950718246 3:14864720-14864742 GAGGGGATGGAGTTGCTGGAGGG + Intronic
951484948 3:23201425-23201447 GCAAGGCCGGTGTGGCTGGAAGG + Intergenic
952712455 3:36444886-36444908 GCTGGGCCGGGGGCGATGGAGGG + Intronic
953222897 3:40989551-40989573 CTGGGGCTGGGGTTGCTGAAAGG - Intergenic
953272380 3:41458065-41458087 GTGGGGCAGGGCTTGCTGGCAGG + Intronic
956605060 3:71065256-71065278 GCGGGGCCGGGGCTGCCGGCGGG + Intronic
961403377 3:126662722-126662744 CATGGGCCGGGGTGGCTGGAGGG + Intergenic
961551492 3:127672709-127672731 GCGGGGCCGGGGTTCAGGGGCGG - Exonic
965166267 3:165196761-165196783 GAGGGGCCGGGGGTGCGGGGGGG - Intronic
965556573 3:170024714-170024736 GCGGGGCGGGGGTTGCTTCCGGG - Intergenic
968043842 3:195612436-195612458 GCGGGGGCGGGGCTGGAGGAGGG + Intergenic
968084273 3:195867545-195867567 GCGGGGGCTGGGGTGCTGGGTGG + Exonic
968493221 4:901491-901513 GCGGGGCCCAGGTGGCTGCATGG + Intronic
968804680 4:2764358-2764380 TCGGGGCGCGGGTTGCGGGACGG - Intergenic
969447307 4:7252675-7252697 GAGGGGCTGGGGGTGCGGGAGGG + Intronic
969520895 4:7677293-7677315 GCCGGGGCGGGGCTGCTGCAGGG - Intronic
969724350 4:8910519-8910541 GGGGGGGCGGGGGTGCTGCATGG + Intergenic
970216733 4:13766822-13766844 GCGGCGGCGGGGTGGGTGGAGGG + Intergenic
970897132 4:21117284-21117306 GCCTGGCCGGGGTTGCCGGGGGG + Intronic
975621648 4:76302741-76302763 GGGGGGGGGGGGTTGGTGGAAGG + Intronic
975784899 4:77877415-77877437 GTGGGGGCTGGGTTGCTGGAGGG + Intronic
976188044 4:82462639-82462661 ACGGGGCGGGGGTTGGGGGAGGG - Intergenic
976226548 4:82798861-82798883 ACGGGGCCGGCGACGCTGGAGGG + Intergenic
976398473 4:84582802-84582824 GCGGGGGCGGGGTCGCGGGCCGG + Intergenic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
984194255 4:176639678-176639700 GTGAGGCCTGGATTGCTGGATGG + Intergenic
985467705 5:12994-13016 GCGGGGGCGGGGTGGCTTGTCGG + Intergenic
985748282 5:1660125-1660147 GCGGGGTCGGGGTCGGTGGGGGG - Intergenic
985778726 5:1858585-1858607 CCAGGGCCGGTGTGGCTGGACGG + Intergenic
986315359 5:6583205-6583227 GCGGGGCCGCGGGGGCTGGGCGG + Intergenic
986809953 5:11346435-11346457 GCAGGGCCGGATTTGCTGTATGG + Exonic
991474406 5:67004247-67004269 GCGCGGCCGGGGCTGGTGGGGGG + Intronic
995181160 5:109231468-109231490 GAGGGGCTGGGGGTACTGGAGGG + Intergenic
997662941 5:135603499-135603521 GCAGGGCCGGGCCTGCTGGGAGG - Intergenic
998165224 5:139838831-139838853 GCTGGGGTGGGGCTGCTGGATGG - Intronic
998266685 5:140672418-140672440 GCTGGGGCGGGGGTGCTGGTTGG - Intronic
999196092 5:149782671-149782693 TAGGGGCAGGGGTTGCTGAAGGG + Intronic
999211698 5:149895155-149895177 GCGGGGCCGGTGGGGCTGGTAGG - Intronic
1001409134 5:171497893-171497915 GCGGGGCAGGGGTTAAGGGAGGG - Intergenic
1001682633 5:173570174-173570196 GGGGGGCTGGGGTTGGGGGATGG - Intergenic
1001773364 5:174311835-174311857 GCAGAGCGGGGGCTGCTGGAGGG + Intergenic
1002330345 5:178436418-178436440 GTGGGGTCGGGGTGGCTGGAAGG + Intronic
1002543093 5:179919334-179919356 GCTGTGCTGGGGCTGCTGGAGGG + Intronic
1002783878 6:386761-386783 GGGAGTCAGGGGTTGCTGGAGGG - Intergenic
1003175699 6:3751251-3751273 GCGGGGCCGGGGACGCGGGAGGG - Intronic
1003403487 6:5809814-5809836 GTGGGACTGGGGTTACTGGAGGG + Intergenic
1006136111 6:31897329-31897351 GGGGGGCAGCGGGTGCTGGAGGG - Intronic
1006456290 6:34133711-34133733 CAGTGGCCGGGGTTGCAGGAAGG + Exonic
1006634409 6:35452121-35452143 CGGGGGCGGGGGTTGATGGAGGG - Intergenic
1007126159 6:39427264-39427286 AAGGGGCCCGGGTTACTGGAAGG + Intronic
1007181059 6:39929525-39929547 GGGGGGATGGGGTGGCTGGATGG + Intronic
1007585926 6:42989460-42989482 GCGGAGCTGGGGTGGGTGGAGGG - Intronic
1007774981 6:44219792-44219814 GCGGGGCCGGGGGGCCTGGCGGG + Intronic
1009878259 6:69533255-69533277 CCAGGGCTGGGGTTGCTGGCTGG - Intergenic
1011983544 6:93416890-93416912 GCGGGGCGGGGGCTGCCAGACGG + Intronic
1012410252 6:98948028-98948050 GCGGGGCCGGGGAGGCGGGGCGG + Intergenic
1015689934 6:135910740-135910762 GTGGAGCCGGGGTTGTGGGAGGG - Intronic
1017085311 6:150707963-150707985 CCGGGGCAGGGGTCCCTGGAAGG - Intronic
1018371008 6:163168393-163168415 CTGGGGCCGGGGTTGCGGGTTGG + Intronic
1018876595 6:167827084-167827106 GCGGGGCCGGGGCCGGAGGACGG - Exonic
1019271296 7:150466-150488 GCGGGGCTGGGATTGCTGCTGGG - Intergenic
1019528362 7:1491363-1491385 GCGGTGCCGGGACAGCTGGATGG + Intronic
1020083057 7:5296735-5296757 GCGGGGCCGGCGGTGATGGGCGG + Intronic
1020141688 7:5615271-5615293 GCAGGGCCGGGGATGCTGACTGG - Intergenic
1021785749 7:24151050-24151072 GTGAGGACTGGGTTGCTGGAGGG + Intergenic
1023054574 7:36281165-36281187 GGGGCCCCGGGGATGCTGGAAGG + Exonic
1023170348 7:37385347-37385369 GCAGGGCCAGTGTGGCTGGAGGG - Intronic
1025996031 7:66528157-66528179 TGGGGGCCAGGGGTGCTGGAAGG + Intergenic
1026010075 7:66629295-66629317 GCGGGGCCGGGGTTGGGGGCGGG + Intronic
1026991334 7:74587656-74587678 ACGGGGCTGGGATTGCAGGAAGG - Intronic
1027250750 7:76397473-76397495 GCGGGGCCGGGGCAGGTGGGCGG - Intronic
1028984056 7:96996211-96996233 GCGGGGGCGGGGTTGGGGGTGGG + Intergenic
1029164324 7:98576310-98576332 GTGGGGGCTGGGTTGCTGAAGGG + Intergenic
1029487882 7:100854268-100854290 ATGGGGCCGGGGGTCCTGGAGGG + Exonic
1029665535 7:101992785-101992807 GCGGGGCGGGGGTTGGAGGGGGG - Intronic
1030597981 7:111562304-111562326 GCGGGGCGGGCGTTGCCGGGAGG - Intronic
1032253181 7:130275410-130275432 GAGGAGCCTGGGGTGCTGGATGG - Intronic
1032410473 7:131690403-131690425 GTGGGGCCGGGGGTGGTGGTAGG + Intergenic
1033253032 7:139777380-139777402 GAGGGGCCGGGGGCGCAGGAGGG - Intronic
1034339325 7:150341707-150341729 GAGGAGCCAGAGTTGCTGGAGGG - Intergenic
1035293892 7:157857111-157857133 GTGGAGCTGGGGATGCTGGAGGG + Intronic
1036551932 8:9823688-9823710 CCAGGGCAGGGGTTGCTGGGTGG - Intergenic
1036635546 8:10547720-10547742 GCGGGGCGGGGGGTGGGGGAAGG - Intronic
1037748190 8:21662898-21662920 GTGGGACGGGGGCTGCTGGATGG - Intergenic
1037789076 8:21920294-21920316 AGGAGGCCGGGGTTGCTGGGGGG - Intronic
1038540330 8:28385825-28385847 GCAGGGCCGGGGTGGCGGGCGGG - Intronic
1043527501 8:81112228-81112250 GCGGGGCCTGGCTTGCTCGCGGG + Intergenic
1045249147 8:100468585-100468607 GCAGGGCAGGGGTGGGTGGAGGG + Intergenic
1045547475 8:103141155-103141177 GCGCGGCGGGGGTGGCTGGGAGG + Intronic
1049462160 8:142735218-142735240 GCGGGGCAGGGGATCTTGGAAGG + Intronic
1049471770 8:142777894-142777916 GCTGGGCCTGGGCTGCAGGAGGG - Exonic
1049641797 8:143719275-143719297 GTGGGGGTGGGGTTGCTGGGGGG - Intronic
1049696501 8:143986604-143986626 GCTGGGCTGGGTTGGCTGGAGGG - Intronic
1052666295 9:31499573-31499595 GCGGGGTGGGGATTGCTGGAGGG - Intergenic
1055446954 9:76393863-76393885 GCGGGGACGGGGTTGAGGGGTGG - Intronic
1055741179 9:79391342-79391364 GAGGGGCCCGGCTGGCTGGAGGG - Intergenic
1056789757 9:89617863-89617885 GTGGGGCAGGGGTTCCTGGCAGG - Intergenic
1057076876 9:92142511-92142533 GCGGGGCTGGGGGTGCGGGTAGG - Intergenic
1057125330 9:92611788-92611810 GTGGCGCCGGGGCTGGTGGAGGG - Intronic
1058351669 9:104032487-104032509 GAGGGGCAGGGGTTGGTGGGCGG - Intergenic
1059269158 9:113061304-113061326 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059270293 9:113066753-113066775 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059271429 9:113072203-113072225 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059272560 9:113077647-113077669 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059273695 9:113083089-113083111 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059274830 9:113088535-113088557 GCGGAGGAGGGTTTGCTGGAGGG - Intergenic
1059404077 9:114089297-114089319 GAGCAGCTGGGGTTGCTGGAGGG - Intronic
1059762766 9:117354703-117354725 GCAAGGCCTGTGTTGCTGGAGGG - Intronic
1060269143 9:122128703-122128725 GCCGGGCCGGGGAGGCTGCAGGG - Intergenic
1060811079 9:126611848-126611870 GCGGGGGCGCGGCTGCTGCAGGG - Intergenic
1061472172 9:130835339-130835361 GCGGGGCCGGGGGCGCCGGGGGG + Intronic
1061702590 9:132427325-132427347 GCATGGCCGGAATTGCTGGATGG - Intronic
1062035910 9:134382431-134382453 GCGGGGCCAGGGCAGCTGGTAGG + Intronic
1062162641 9:135088400-135088422 GCGGGGCCGGGGGAGCTTGGTGG + Intronic
1062388844 9:136326177-136326199 CCGGGGCCGTGGCTGCTGGCCGG - Intergenic
1062714263 9:137998106-137998128 GTGGGGTGGGGGTTGCTGGGAGG + Intronic
1186357396 X:8801672-8801694 AAGGGGCAGGGGTGGCTGGAAGG - Intergenic
1188274093 X:28178645-28178667 GCGGGGTGGGGGGTGCGGGACGG + Intergenic
1188491747 X:30745301-30745323 GTGGGGCCAGGGTGGCTGCAGGG - Intergenic
1189137174 X:38561766-38561788 GCTGGGTCGGGGCTGCAGGATGG + Intronic
1189304201 X:39974420-39974442 GGGGGGCGGGGGTAGGTGGAGGG - Intergenic
1190092991 X:47455947-47455969 GAGGGGCCATGGATGCTGGAGGG - Exonic
1190246910 X:48696838-48696860 GCCGGGCCGGGTGGGCTGGAGGG + Intronic
1195174907 X:102305844-102305866 GGGGTGCCGGGGGTGCGGGAGGG + Intergenic
1195183958 X:102381249-102381271 GGGGTGCCGGGGGTGCGGGAGGG - Intronic
1196581650 X:117386436-117386458 GCGGGTCAGGGGTTTCTGAAAGG + Intergenic
1198129097 X:133676130-133676152 GGGCTGCCGTGGTTGCTGGAAGG + Intronic
1199408425 X:147490845-147490867 GTGGGGTGGGGGTTGGTGGAGGG - Intergenic
1202196964 Y:22306789-22306811 GTGGGGAGGGGGTTGCGGGAGGG + Intergenic